~1nt difference every 160 nt

1. SNPs ~1nt difference every 160 nt

3. ~1nt difference every 160 nt

5. YJM789a lys2 LYS5 HOdrugr X S96 a LYS2 lys5 hoDRUGS a lys2 LYS5 ho drugr 10 spores

7. YJM789a lys2 LYS5 ho drugr X S96 a LYS2 lys5 HO DRUGS a lys2 LYS5 ho drugr 10 spores

9. a drugr a pdr5 YJM789a lys2 LYS5 ho drugr X a pdr5 drug resistant?

11. Sears et al., Fig. 2

12. Sears et al., Fig. 3 1 Ura+ Lys- 1 Ura- Lys- 1 Ura+ Lys+ 1 Ura- Lys+ 2 Ura- Lys- 2 Ura+ Lys+ 1 Ura+ Lys- 1 Ura- Lys- 2 Ura- Lys+

14. Sears et al., Fig. 2

16. The geneticist’s questions a) What is consequence of reduced gene function? b) What is the consequence of increased gene function? c) What does the gene (protein) interact with? When and where is the gene (protein) expressed?

17. The geneticist’s toolkit Genetical 1) Mutations point,deletion, RNAi 2) More mutations enhancers, suppressors 3) Gene overexpression (gain-of-function) Molecular biological 4) Measure gene expression reporter genes, Northern blot, RT-PCR, in situ hybrdz DNA microarrays 5) Protein interaction 2-hybrid pull-down

18. 1978

19. URA3 URA3 URA3 URA3 AmpR • low freq. transformation • ~ 1-10 / ug YIp polylinker ori • stable transformants • (integrated) • low copy # • (integrated) • DNA homol. req.

20. Ars URA3 AmpR • hi freq. transformation • >103 / ug YRp polylinker ori • unstable transformants • (autonomous) • > 90% plasmid loss • moderate copy # • (~ 20/cell) • homol. recomb. NOT req.

21. URA3 2 • hi freq. transformation • ~ 103 / ug AmpR YEp polylinker ori • stable transformants • (autonomous) • < 1% plasmid loss REP1 REP2 FLP • hi to very hi copy # • (~ 50-1000/cell) • homol. recomb. NOT req.

22. Ars URA3 AmpR • hi freq. transformation • > 103 / ug polylinker YCp ori • stable transformants • (autonomous) • < 1% plasmid loss CEN • low copy # • (1-3/cell) • NO DNA homol. req.

23. Ars Ars URA3 URA3 ori polylinker AmpR CEN AmpR polylinker TEL rsn site YAC TEL ori CEN

24. Cloning genes by complementation Ars URA3 genomic fragments AmpR YCp ori CEN yfg-

25. Glu protein kinase? URA3 2 High copy suppressors AmpR genomic fragments YEp ori REP1 REP2 FLP

26. The geneticist’s questions a) What is consequence of reduced gene function? 1) gene knockout (deletion) b) What is the consequence of increased gene function? c) What does the gene (protein) interact with? When and where is the gene (protein) expressed?

27. Tag 1 PCR Tag 2 kanMX4 ATCGGATTCATAACTGATAG GCTTACTGAAACTGAAACTC Ron Davis et al., Stanford University Each deletion strain tagged with two unique 20mers kanMX4

28. “Bar-coding gene deletions ATCGGATTCATAACTGATAG GCTTACTGAAACTGAAACTC kanMX4 YFG kanMX4 Ron Davis et al., Stanford University

29. Hybridize labeled tags to oligonucleotide array containing tag complements Each tag has unique location Bar-coded gene deletions Ron Davis et al., Stanford University

30. . . . . . . One tag One Deletion Strain 1 GATTCGATAGCCGGCAAGG CGATTTAGGAATGTCATAG 2 . AGCTCATACCTAGTAACTA 3 . . AGCTCATACCTAGTAACTA 6,200 Ron Davis et al., Stanford

31. Apply Selection Determine who is missing. Parallel analysis of deletion strains Determine who is here.

32. Parallel Analysis of Gene Function Before selection Strains are present in equal abundance in the population and produce signals of equal intensity on the chip After multiple population doublings under selection Strains with a growth defect are under-represented in the population and produce a lower intensity signal Ron Davis et al., Stanford University

33. Bar-codes reveal genes required for growth Winzeler et., 1999 Science 285:901-906

34. Figure 5: Growth of deletion strains exhibiting reduced fitness in galactose media. Guri Giaever et al. et Ron Davis et al., Stanford

35. Results Conventional analysis ~25% have growth defect 17.6% dead (~ 1100 essential genes) ~ 8% slow growth Parallel analysis ~40% have growth defect(<98% of wt growth rate) • Many new genes implicated in key biological processes • Gene regulation poorly predicts mutant phenotype

36. The geneticist’s questions a) What is consequence of reduced gene function? gene knockout (deletion) b) What is the consequence of increased gene function? What does the gene (protein) interact with? suppressors, enhancers When and where is the gene (protein) expressed?

37. X gene X yfg1 X

38. S R S R S S R R bni1::NatR yxx::KanR

42. Parallel pathways revealed in double mutants Mutations in 1, 2, 3 are “synthetic lethal” with mutations in 4,5 1 4 2 5 3

45. The geneticist’s questions a) What is consequence of reduced gene function? gene knockout (deletion) b) What is the consequence of increased gene function? What does the gene (protein) interact with? suppressors, enhancers When and where is the gene (protein) expressed? protein localization

46. GFP your favorite gene your favorite protein GFP

47. Protein localization images Nucleus Nuclear periphery Endoplasmic reticulum Bud neck Mitochondrion Lipid particle

48. The geneticist’s questions a) What is consequence of reduced gene function? gene knockout (deletion) b) What is the consequence of increased gene function? What does the gene (protein) interact with? suppressors, enhancers physical interaction When and where is the gene (protein) expressed? protein localization

49. MATa MAT prey prey bait bait X AD AD BD BD HIS3 Uetz et al et Fields, 2000

50. Activation domain array Uetz et al et Fields, 2000