1 / 39

Cell-free

Protein Expression Systems. Bacterial. Cell-free. Yeast. Mammalian. Insect. Protein Expression in Bacteria. Advantages/disadvantages Genetic elements essential for the expression Cloning strategies Overview of the available expression systems and expression strains

Patman
Télécharger la présentation

Cell-free

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Protein Expression Systems Bacterial Cell-free Yeast Mammalian Insect

  2. Protein Expression in Bacteria Advantages/disadvantages Genetic elements essential for the expression Cloning strategies Overview of the available expression systems and expression strains Design of cloning procedures using the VNTI program

  3. Advantages • Fast growth • Cheap medium and equipment for growing • Good knowledge of the host

  4. Disadvantages Limitation for expression of eukaryotic proteins due to: • different frequencies with which the different codons appear in genes of these organisms E.g. CGT, CGC, CGG, AGG, AGA, CGA code for arginine, but the last 3 (AGG, AGA, CGA) are rarely used in E. coli and it has low amounts of respective tRNAs. • differences in post-translational modifications (SS bonds, glycosylation etc)

  5. Disadvantages • Accumulation of lipopolysaccharides (generally referred to as endotoxins) …

  6. Goals To obtain as much as possible /good expression+good cell growth soluble folded protein /reduced aggregation in a form that is easy to purify /use of secretion and tags Common problem: High expression=danger of aggregation, decreased cell growth

  7. Genetic Elements Essential for Expression

  8. RBS, START, and STOP Ribosome Bindind Site (RBS): RBS RBS 5-9 n START GAAGGAATTCAGGAGCCCTTCACCATG ... ... START codons: E. coli uses 77% ATG (AUG), 14% GTG (GUG), 8% TTG (UUG) and a few others STOP codons: TAG (UAG), TGA (UGA), TAA (UAA)

  9. Genetic Elements Essential for Expression

  10. Promoters Host’s promoters 2500 in the entire genome of E. coli K12 strain Most frequently used: Plac / Ptac / Ptrc, PPBAD, rhaPBAD • Regulation of expression Promoters from phages T7, T3, SP6, T5, PL - Highly efficient and specific expression

  11. Plac: Regulation

  12. Plac, Ptac, Ptrc: Characteristics

  13. PPBAD: Regulation

  14. PPBAD and RhaPBAD

  15. Phage Promoters

  16. Combinations

  17. Genetic Elements Essential for Expression

  18. Replication Origin

  19. Co-expression from two plasmids

  20. Protein Expression in BacteriaPart2 Cloning strategies Overview of the available expression systems and expression strains Design of cloning procedures using the VNTI program

  21. Types of Expression Vectors 1 2 3

  22. Insertion into Transcriptional Vectors

  23. Insertion into Translational Vectors

  24. Cloning Using Restriction Enzymes NcoI HindIII

  25. Cloning Using A-overhangs

  26. TA-Cloning with Topoisomerase

  27. Directional Cloning CACC

  28. Gateway Technology

  29. Expression of Fusion Proteins • We may fuse the target protein with • various tags to facilitate its purification or detection HHHHHH-target, epitope-target • highly soluble proteins to improve solubility and to facilitate purification Thioredoxin-target, GST-target • signal peptides or other proteins or domains to promote secretion SP-target

  30. ‘Short’ Fusion Protein Construction ATG CAT CAC CAT CAC CAT CAC

  31. ‘Long’ Fusion Protein Construction NcoI HindIII PstI HindIII

  32. pUC18/19 Transcriptional vector

  33. pTrc99 Translational vector

  34. pQE Translational vector +CDR

  35. pET

  36. pCR&pEXP

  37. pBAD

  38. Expression strains

  39. Expression optimization To optimase: Level of inducer (e.g. arabinose) Time of induction Temperature of the induction step (popular - 18oC overnight)

More Related