160 likes | 253 Vues
Effects of -Calpain DNA Tests on Tenderness. R. Mark Thallman U.S. Meat Animal Research Center Clay Center, NE. -Calpain. Quantitative Trait Locus (QTL) for WB Shear Force on Bovine Chromosome 29 -calpain gene located in the region of the QTL
E N D
Effects of -Calpain DNA Tests on Tenderness R. Mark Thallman U.S. Meat Animal Research Center Clay Center, NE
-Calpain • Quantitative Trait Locus (QTL) for WB Shear Force on Bovine Chromosome 29 • -calpain gene located in the region of the QTL • -calpain is a proteolytic enzyme that plays a key role in postmortem tenderization of meat
MARC -Calpain Team • Renee Godtel • Kevin Tennill • Steve Simcox • Linda Flathman • Tim Smith • Eduardo Casas • Roger Stone • Brent Page • Stephen White • Mohammad Koohmaraie • Tommy Wheeler • Steven Shackelford
Tests for -Calpain are Marketed By: • Frontier Beef Systems - TenderGENE • Genetic Solutions – GeneStar Tenderness II • MMI Genomics – plan to market with their parentage products
P×A L×J QTL on Bovine Chromosome 29 BTA29 BTA29 Tough Tender Tough Tender
What is an SNP?(Single Nucleotide Polymorphism) Functional Genotype Functional Mutation Test Location Test Result +/- AGAATTTGAATTGTGATGAACACTCCAC AGAATATGAATTGTGATGAACAGTCCAC +/- +/+ AGAATTTGAATTGTGATGAACACTCCAC AGAATTTGAATTGTGATGAACACTCCAC +/+ Association between test result and functional mutation Or, the test polymorphism may actually be the functional polymorphism, but that is difficult to prove and not really necessary.
P×A L×J SNP Association G | A C | G G | A C | G 316 316 530 530 Tough Tender Tough Tender
Possible Test Results Can be Viewed from Two Perspectives Haplotype SNP 530 SNP 316 Haplotype
Reporting Results with Multiple SNP Haplotype SNP 530 SNP 316 Haplotype Genotype frequencies
Genotypic Effects on WB Shear Force (lb)(higher is tougher) SNP 530 SNP 316 ASA 362 hd
Two Possible Models for Observed Intermediate Haplotype Effect Avg. Effect of Haplotype Effect Freq. Three Functional Alleles Mixture of Two Functional Alleles C G C G 316 316 -.22 .07 Tender .193 530 530 G G G G G G 316 316 Intermediate 0 .527 530 530 G A G A 316 316 Tough .09 .06 .268 530 530 Too Rare to Estimate Well -.10 .34 .011 C A C A 316 316 530 530 GPE Cycle VII-2 557 hd
G | G G | G 316 B×H 530 Tough Tender A Challenge and … • Heterozygous for QTL, but homozygous at test loci. • Red vs blue alleles in progeny are determined by flanking microsatellites
B×H … an Opportunity • This situation suggests rather strongly that the G-G haplotype is actually associated with a mixture of functional alleles. • Provides opportunity to make the test more powerful by adding SNP G | G | T G | G | C 316 530 SNP X? Tough Tender
Why Did We Discover this Opportunity to Improve the Test? • Because we looked • Because we had an appropriate population in which to find it
We Are Learning a Great Deal From the -Calpain DNA Test • Multiple SNP present some challenges. • The test works very well as it is. • I am confident that it will work even better when we add a few more SNP to it.
Conclusions • DNA testing is not as simple as it first appears. • DNA tests should be viewed as very fluid systems. • The potential benefits are enormous. • It will eventually become widespread in cattle breeding. • It is important that producers have realistic expectations