Lipase: protein that hydrolyses lipids Polymerase: protein that builds polymers

1. Naming enzymes Lipase: protein that hydrolyses lipids Polymerase: protein that builds polymers Ligase: protein that ligates DNA fragments Proteinase or protease: protein that hydrolyses proteins DNase: protein that hydrolyses DNA RNase: protein that hydrolyses RNA

2. Quiz 1 closes tomorrow morning 9 am Tomorrow 4 pm in T4 Prac room: safety and lab induction by Vance Lawrence

3. Lecture 4 Basic methods PCR and mutation Adapted from David Tscharke @ RSB

4. Lecture overview • Hybridisation • Melting temperature • Cutting DNA • Restriction endonucleases • Polymer chain reaction (PCR) • hybridisation • DNA amplification • mutation

5. Watson and Crick Nucleic acid base-pairing relies on hydrogen bonds being stronger than the repulsive force of the –ve charge on the backbones

6. Base pairing is reversable Denaturation Melting Hybridisation Annealing Renaturation

7. Manipulating base pairing Low salt High temp High pH Low ‘G+C’ High salt Low temp High ‘G+C’

8. Hybridisation jargon I • Tm: temperature at which hybrids are 50% melted • Equilibrium point between melting and annealing

9. Hybridisation jargon II • Stringency: ease at which hybrids form • Stringent conditions favour fidelity • Tm is used to standardize stringency • There are two rules to work out Tm • one for short lengths of DNA • one for longer (> 30 bp) lengths

10. Primer design Coming to a tute near you soon!

11. Calculating Tm (in oC) • For fragments > 30 bp • DNA-DNA hybrids: • Tm = 16.6log[Na+] + 0.41(%G+C) + 81.5 • RNA-RNA hybrids: • Tm = 79.8 + 18.5log[Na+] - 0.584(%G+C) + 11.8(%G+C)2 • DNA-RNA • The average of DNA-DNA and RNA-RNA • For short DNA (oligonucleotides) • Rule of thumb: 4 (# of C or G) + 2 (# of A or T) • Assumes physiological salt (0.9% NaCl or ~100 mM)

12. Stringency and fidelity DNA sequences (A – F) DNA sequence (A) Non-stringent (Tm – 30 ºC) Stringent (Tm – 15 ºC) temperature rises mismatches tolerated hi-fidelity Alberts

13. The key is to bias the outcome If you want highly stringent hybridisation - keep temperature high - in some applications can use lower salt - in some applications can add formamide - can sometimes choose sequence If you want ‘sloppy’ hybridisation - use lower temperature

14. PCR Revolutionized molecular biology

15. DNA pol 5’ 3’ PCR is a polymerase-based method 3’ 5’ Polymerases need? • Primers • dNTPs (dATP, dCTP, dGTP, dTTP) • The right buffer / temperature conditions • Same goes for PCR

16. Both strands of DNA are copied in PCR 5’ 3’ 3’ 5’ + 2 primers + polymerase + dNTPs Denature 5’ 3’ 3’ 5’

17. The copying is repeated… Old and new DNA strands can be templates original template original template Denature Primers, pol, dNTPs all still there! orig. orig. The primers define the length of the copies made from the new templates

18. PCR is a dance with 3 steps 100 Denaturation Temperature (ºC) 90 80 70 Extension 60 50 Annealing 1 2 3 4 5 6 7 Time (min) Adapted Brown 9.6

19. What kind of enzyme works at 72 oC? • In the beginning, PCR used Klenow subunit • C-terminal part of E. coli Pol I • Not heat stable • DNA synthesis done at 37 oC • More had to be added in every cycle • The breakthrough came from Thermus aquaticus • Likes it hot • Has a polymerase that works best at 72 oC = Taq • Allowed automation of PCR • Higher stringency for primer binding • Taq named ‘molecule of the year’ in 1989 by Science

20. Amount of PCR product 0 10 20 30 40 Number of cycles Theory versus reality • DNA amplification by PCR is not exponential • Approaches exponential for first ~20 cycles

21. Limitations to amplification • Limitation of primer or nucleotides • Amount of primers and nucleotides in the reaction mix can become exhausted • Lifetime of the polymerase • Even Taq doesn’t like 94 oC for too long • Competition between template and primer • Newly synthesised DNA strands compete with the primers for annealing to the DNA for use as template

22. Limitations associated with Taq • Only good for relatively short stretches • Error rate is about 1 in 9,000 nucleotides • 5 kb is about the limit for Taq • PCR products have errors • Errors made in early cycles are multiplied • 1 in every 300 bp by the end of 30 cycles • Both problems arise because Taq lacks ‘proof-reading’ ability • 3’→ 5’ exonuclease activity to remove misincorporated bases • Some errors cause Taq to stall

23. Alternatives to Taq • A variety of thermostable polymerases that have proof-reading ability have been found • Essential if fidelity of sequence is important • Taq remains the most commonly used polymerase for PCR • Cheap, robust • Vent is a polymerase with 3’→5’ proof-reading • Similar cost as Taq but 10-fold higher fidelity • Phusion is a polymerase with 3’→5’ proof-reading • 50-fold lower error rate than Taq • Can amplify 10 kb plasmids reliably • 3 times more expensive than Taq

24. Controls for PCR • PCR turns a few copies into hundreds of millions • Any error made in the beginning is also amplified • Contamination of product into reagents is a hazard • A big issue in diagnostic and forensic applications • Separate rooms can be used for DNA extraction, reaction preparation and analysis of products • Be skeptical of PCR-based claims • A ‘water’ control is essential if you are claiming detection of a DNA sequence by PCR • For preparative PCR, contamination is less of an issue • e.g. just making more of a particular DNA sequence

25. Parameters that affect PCR EVERYTHING! Primers and annealing temperature most important Easy when starting from plasmid rather than genomic DNA

26. Choosing the right parameters • Too short = lack of specificity • A given 8-mer appears ~46,000 times / genome by chance • Too long = annealing temperature becomes too high • Also… longer primers are more likely to have errors • …and you’ll go broke (oligos are charged by the bp) • 17 – 25 bp is usually good • Want Tm to be around 55 – 65 oC • Tm more important than G+C content • Choose closer to 50% G+C if you have the choice • - 3’-end should be a G or C if possible • Avoid runs (AAAAA or CCCC) and self-complementarity

27. Choosing the right primer pair Sense, 5’ or forward primer Binds to the BOTTOM strand 5’ 3’ 3’ 5’ Anti-sense, 3’ or reverse primer Binds to the TOP strand • Naming is with respect to the sequence of the TOP strand • Primers (like all DNA) written 5’→ 3’ • Sense primer will have the same sequence as the top strand • Anti-sense primer will be the complement of the top strand • Match Tm • Compensate for GC differences by changing lengths • Avoid pairs that bind to each other

28. Choosing the right annealing temperature • Too low promotes promiscuous priming • Non-specific products • Too high and you get no priming • Rough calculation of Tm (in oC) • 4x(# of G or C) + 2x(# of A or T) • Annealing temperature is generally between Tm and Tm – 5 oC • Can have only one annealing temperature! • - Must be OK for both primers

29. Primer CGTTGCTGATAGGATC Template (wrong) GCA CGA TAT CTAG T T G The problem of mispriming in early cycles Primer CGTTGCTGATAGGATC GCAACGACTATCCTAG Template ThiswrongDNAnow has a perfect primersequence on the end Will propagate as efficiently as the desired product in future cycles

30. Refinements For fidelity It’s most important to reduce mispriming in early cycles: Hot-start - combine reagents cold and start the first cycle by placing sample in a well that has been pre-heated at 94 oC - stops mispriming as the sample warms up in first cycle

31. PCR success / failure • Well designed primers, good quality template • Little trouble • Little need for optimisation or refinement • It just works • Bad primers or tricky templates (e.g. high G=C) • Big trouble • Lots of optimization • Much misery!

32. Summary • PCR is a powerful technique that allows amplification of a chosen sequence of DNA • Each new strand of DNA can become a template • The power of PCR is also its Achilles heel • Controls without input template are important • Taq is an error-prone enzyme • Errors in early cycles are amplified • Good primers and the right annealing temperature are the key to successful PCR • Adequate Tm for primers, suitable annealing temperature

33. Changing the nucleotide sequence by PCR New restriction sites Site-directed mutagenesis

34. 5’ CGAGAATTC 3’ CCTTACGCGATTACTGACAGG AGGCCTGGAATGCGCTAATGACTGTCCGGACATGCT 3’ 5’ PCR can add new ends to insert The 5’ end of a PCR primer does not need to match the template

35. 5’ CGAGAATTC 3’ CCTTACGCGATTACTGACAGG AGGCCTGGAATGCGCTAATGACTGTCCGGACATGCT 3’ 5’ New ends by PCR • Add useful restriction sites to the 5’ end of primers • Make sure the Tm of the template-specific part is still OK • If adding RE, need extra bases so the RE site is not right on the end EcoRI Always: purify PCR product (agarose gel) purify linearized vector (agarose gel)

36. Protein mutation by PCR I • Selectively replace a codon for a new one • PCR with mutation primers • Mismatch at the mutation site z z • 2 PCR reactions • Red primers • Blue primers z

37. Protein mutation by PCR II Mixing and annealing the PCR products • During 3rd PCR with the original terminal primers • Primer extension completes one of the duplexes z z z z • Amplification of full-length product z

38. AGGCCTGGAATGCGCTAATGACTGTCCGGACATGCT 3’ 5’ Protein mutation by PCR III • Good mutation primers • have about 1.5 times more nucleotides downstream than upstream of the mutation site • match the Tm of the other primers • end with a G or C at the 3’ end z GCGATTACTGAACAGCCTGTA 3’ 5’

39. PCR primers • $0.4 per nucleotide • Up to 30mer is usually reliable • Up to 60mer may be OK • Longer sequences need gel purification • Much longer sequences need confirmation by sequencing • A good primer makes a GC base pair at the 3’ end

40. Summary • PCR for changing DNA and mutating proteins • Primer design • Add/insert/delete nucleotides • Only Tm of matching segments matters • Inserts and deletions of any length possible