1 / 14

Hudson, B.P., Quispe, J., Lara-Gonzalez, S., Berman, H.M., Arnold, E., Ebright, R.H.,

EMD-5127 – PDB 3IYD Three-dimensional EM structure of an intact activator-dependent transcription initiation complex. Hudson, B.P., Quispe, J., Lara-Gonzalez, S., Berman, H.M., Arnold, E., Ebright, R.H., Lawson, C.L. (2009) Proc. National Acad. Sci. USA 106,   19830-19835. Acknowledgements.

anevay
Télécharger la présentation

Hudson, B.P., Quispe, J., Lara-Gonzalez, S., Berman, H.M., Arnold, E., Ebright, R.H.,

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. EMD-5127 – PDB 3IYDThree-dimensional EM structure of an intact activator-dependent transcription initiation complex Hudson, B.P., Quispe, J., Lara-Gonzalez, S., Berman, H.M., Arnold, E., Ebright, R.H., Lawson, C.L. (2009) Proc. National Acad. Sci. USA 106,   19830-19835

  2. Acknowledgements http://roma.rutgers.edu Catherine Lawson, PI Helen Berman, co-PI Brian Benoff Jens Birktoft Brian Hudson ** Samuel Lara-Gonzalez Andrew Napoli Ramya Rao Kaitlyn Turo Collaborators Rutgers Richard Ebright Eddy Arnold Scripps Joel Quispe Bridget Carragher Clint Potter Funding: NIH GM021589

  3. Bacterial Transcription Activation 3 components: Activator (50 kDa) RNA polymerase (300 kDa) Promoter DNA (~100 base pairs) Total: ~ 500 kDa

  4. Sample Reconstitution +1 CAP (-61.5) -35 -10 ATAATCGCACCTTA ATAATCACACCTTA CGCAATAAATGTGATCTAGATCACATTTTAGGCAAAAAAGGCTTTACACTTTATGCTTCCGGCTCGT TGTGAGCGGATAACAAG GCGTTATTTACACTAGATCTAGTGTAAAATCCGTTTTTTCCGAAATGTGAAATACGAAGGCCGAGCA ACACTCGCCTATTGTTC

  5. EM Specimen • Carbon sandwich stain technique Carbon Film Uranyl Formate Stain Sample Carbon Film Grid Ohi et al, Biol. Proced. Online (2004), 6, 23-34.

  6. EM Reconstruction Particles (~17000 total) • EMAN projection matching • thermophilic RNAP starting model yielded density for E. coli-specificinsertions at expected positions First refinement cycle projections averages Final refinement cycle projections averages

  7. Resolution Estimation

  8. “Class I” Map + Interpretation EMDB ID EMD-5127 PDB ID 3iyd

  9. Initial Model Fitting T. thermophilus RNAP holoenzyme from Mukhopadhyay et al., 2008 (PDBid 3DXJ). CAP + CTD + DNA from Benoff et al., 2002 (PDBid 1LB2), CTD + 70 region 4 + DNA from Lara et al, manuscript in preparation DNA positions -23 to +20 from Lawson et al., 2004. E. coli subunit N-terminal domain dimer from Zhang & Darst, 1998 (PDBid 1BDF). E. coli70 regions 1.2 to 2 from Malhotra et al., 1996 (PDBid 1SIG). E. coli’GNCD from Chlenov et al., 2005 (PDBid 2AUK).

  10. Coordinate Model Generation • Rigid body fitting, multiple models (Chimera) • DNA helical path adjusted around -35 element (3DNA) • Unified RNAP homology model created (Modeller) • Domain-wise fitting (Yup.scx, improved overall map-model correlation coefficient from 0.77 to 0.85) • Geometry regularization (phenix.pdbtools)

  11. Coordinate Model Quality Phenix.pdbtools geometry regularization: • No close contacts • RMSD bonds 0.005 Å • RMSD angles 0.8 degrees • Unrealistic phi-psi angles: 500/4000 residues (12%)

  12. Reviewer Comment “the value of such a reconstruction is … in having a model for E. coli RNAP (which contains significant differences from the thermophilic enzymes) and in providing a framework for testing positions/interactions involving parts of the complex that have not been available previously. “

  13. Fitting Statistics

  14. Euler Frequency Distribution

More Related