1 / 4

*** CTG GGA GAT TAT GGC TTT AAG *** CTG GGA TAA G codon alignment

Frameshift. *** CTGGGAGATTATGGCTTTAAG*** *** CTGGGA- - - - - - - - - - -TAAG*** 11 bp deletion, alignment. *** CTG GGA GAT TAT GGC TTT AAG *** CTG GGA TAA G codon alignment. Leu Gly Asp Tyr Gly Phe Lys Leu Gly STOP G translation.

betha
Télécharger la présentation

*** CTG GGA GAT TAT GGC TTT AAG *** CTG GGA TAA G codon alignment

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Frameshift *** CTGGGAGATTATGGCTTTAAG*** *** CTGGGA- - - - - - - - - - -TAAG*** 11 bp deletion, alignment *** CTG GGA GAT TAT GGC TTT AAG *** CTG GGA TAA G codon alignment Leu Gly Asp Tyr Gly Phe Lys Leu Gly STOP G translation

  2. Silent *** CTG GGA GAT TAT GGC TTT AAG*** *** CTG GGA GAT TAT GGC TTC AAG*** alignment Leu Gly Asp Tyr Gly Phe Lys Leu Gly Asp Tyr Gly Phe Lys translation

  3. Missense *** CTG GGA GAT TAT GGC TTT AAG*** *** CTG GGA GAT TAT GGC TAT AAG*** alignment Leu Gly Asp Tyr Gly Phe Lys Leu Gly Asp Tyr Gly Tyr Lys translation

  4. Nonsense *** CTG GGA GAT TAT GGC TTT AAG*** *** CTG GGA GAT TAG GGC TTT AAG*** alignment Leu Gly Asp Tyr Gly Phe Lys Leu Gly Asp STOP translation

More Related