DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures

1. DNA Mismatch Repair-Dependent Suppression in Genotoxicity of Complex Environmental Carcinogenic Mixtures Casey Kernan Mentor: Dr. Andrew Buermeyer Department: Environmental & Molecular Toxicology Oregon State University

2. Colorectal Cancer (CRC) • 2nd leading cause of cancer deaths worldwide • CRC claims nearly 50,000 lives/year in U.S. • American Cancer Society estimates 147,000 new cases by 2011

3. Lynch Syndrome (HNPCC) • Autosomal dominant genetic condition • Mutation in one or more of the 4 MMR genes: MLH1 & PMS2 (MutLα) and MSH2 & MSH6 (MutSα) MSH6/ 3 MSH2 PMS2 MLH1

4. Mismatch Repair A number of cellular pathways, processes and environmental genotoxins interact to influence an individual’s susceptibility and risk for developing cancer. Apoptosis

5. Recognition of Mismatch MLH1 MSH6/ 3 MSH2 PMS2 MSH6/ 3 MSH2 ATP ADP • DNA replication error rate = 1 mispairing/ 104-105 basepairs • MutSheterodimer locates and binds mismatch • MutLheterodimer recruited and endonuclease activated

6. Excision of Mismatch MSH6/ 3 MSH2 hEXO1 • Exonuclease1 Activity: 5’  3’ directed hEXO1 PMS2 • RPA (Replication Protein A) • Binds ssDNA, prevents degradation, promotes Polymerase δ, MLH1 RPA

7. Correction of Mismatch c c PCNA RFC Polδ/ε DNA Ligase RPA Nick PCNA = Proliferating Cell Nuclear Antigen RFC = Replication Factor C Polδ/ε = DNA Polymerase Delta/Epsilon

8. Mutator Phenotype • Mutations are a driving force behind cancer development Mutated MMR genes Aberrant MMR proteins Replication errors bypass defective MMR systems Enhanced proliferation Mutations inactivate tumor suppressor genes and enable onco-genes (APC gene) Mutated cells divide MLH1 • unchecked growth • loss of apoptotic ability • acquisition of metastic ability • resistance to chemotherapeutic agents (6-TG, MNNG, 5-FU)

9. PAHs – The Environmental Influence • Mutagenic and carcinogenic - large nonpolar compounds • Exposure: diet, smoking, grilling food, fossil fuel processing • Metabolized forming highly reactive diolepoxides (DE) • Benzo[a]pyrene is metabolically activated to benzo[a]pyrenediolepoxide (BPDE) which binds to DNA forming bulky DNA adducts

10. Big Question Global Hypothesis Specific combinations of environmental exposures and cellular deficiencies interact to influence cancer risk in individuals Specific Hypothesis MMR is a key pathway for reducing deleterious consequences (mutations) from PAH exposure Prediction Cells lacking MMR will show increased PAH-induced mutation

11. 3 Questions: 1.) General phenomena of MMR-deficiency? 2.) What are the extra mutations induced? 3.) General phenomena of PAH’s, in complex mixtures?

12. Hypothesis • We hypothesize that results seen with HCT 116 lines do reflect differences in MMR status rather than other potential known or unknown differences in the cell lines. • -Verify using DLD1 cell lines proficient and deficient in MSH6 • We hypothesize that MMR-dependent suppression of BPDE-induced mutations represent a phenomenon generalizable to other PAH’s, including environmentally relevant complex mixtures.

13. BPDE-Induced Mutation Forward mutations induced by exposure to PAH’s are measured using the reporter gene hypoxanthine-guanine phosphoribosyltransferase (HPRT) 657bp HPRT+ HPRT- HPRT+ HPRT- HAT media – 5 passages HPRT- mutant cells survive in 6-Thioguanine selective media Clear pre-existing mutants 1 hour BPDE exposure Doses: 0, 25, 50, 100 nM Grown 8 days to insure no HPRT+ protein present Gene HPRT- Protein HPRT+/- Bulky PAH-DNA adducts

14. Cell Lines MMR ProficientMMR Deficient HCT 116 + Ch3 HCT 116 + Ch2 MSH6- WT MSH6+ WT MLH1+ MLH1- DLD1+Ch2 DLD1

15. Mutant Frequency Calculation 135,000 cells 135,000 cells 300 cells 300 cells MMR Deficient MMR Proficient 6-TG selective media Non-selective media 6-TG selective media Non-selective media MLH1 MLH1 few colonies ~150 colonies more colonies ~150 colonies MF=6-TG resistant colonies formed/(PE x # of plates) MF=mutant frequency PE = plating efficiency

16. Results: PAH-induced mutation in MSH6- deficient cells, similar to previous MMR+ proficient cells • Technical issue with low plating efficiency in MSH6+

17. Mutation Identification v 2 3 4 6 7 8 9 10 11 12 trypsinized cloning disc 2 3 4 5 6 Centrifuge Total RNA Purification

18. RNA  cDNAPCR sequence Reverse Transcriptase - PCR cDNA PCR – amplify HPRT gene Primers P3: -36 to -17 5’ CCTGAGCAGTCAGCCCGCGC 3’ P4: 701 to 6825’ CAATAGGACTCCAGATGTTT 3’ Sequencing agarose gel electrophoresis

19. Agarose Gel Electrophoresis Batch 3 PCR Products – HCT 116+2 HPRT Mutants CONTROLS Mutant: 45 18 44 6 13 22 24 26 27 49 50 80 81 HPRT product 657bp

20. Spectrum of HPRT Mutations Spectrum Key 58.3% GC →TA transversion Insertion of one nucleotide base GC →CG transversion 4.2% GC →AT transition Deletion of one nucleotide base AT →GC transition 25.0% 12.5%

21. Conclusion • Preliminary data suggest: • BPDE-induced spectra in MLH1 deficient cells different from spontaneous mutations • Too soon to tell if induced spectra differs in MMR proficient vs. deficient cell lines

22. Future Investigations • Continue mutant analysis on remaining clones: • HCT 116+Ch2 • HCT 116+Ch3 • DLD1 • DLD1+Ch2 • Complex environmental mixtures • Mutant frequency • Individual mutation analysis

23. Research Goals & Significance Goals • Understand MMR functions as well as genetic influences and their combined role in normal responses to carcinogens • Accurate evaluation of an individuals susceptibility and risk to developing CRC • Provide insight for more effective and practical CRC screening methods • Develop novel models for studying other genetic and environmentally linked diseases

24. Acknowledgements • Howard Hughes Medical Institute • Environmental Health Sciences Center • Dr. Andrew Buermeyer • Jacki Coburn • Fatimah Almousawi • Kimberly Sarver • Dr. VidyaSchalk • Dr. Kevin Ahern, program coordinator