1 / 35

ACCESSING AND EXTRACTING CHIP-SEQ AND TF-GENE INTERACTIONS FROM PAZAR

ACCESSING AND EXTRACTING CHIP-SEQ AND TF-GENE INTERACTIONS FROM PAZAR. Jonathan Lim With Introduction by Wyeth Wasserman. Welcome. If you encounter any technical difficulties during the webinar, type a report using the chat option Slide presentation ~25 min

dinesh
Télécharger la présentation

ACCESSING AND EXTRACTING CHIP-SEQ AND TF-GENE INTERACTIONS FROM PAZAR

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. ACCESSING AND EXTRACTING CHIP-SEQ AND TF-GENE INTERACTIONS FROM PAZAR Jonathan Lim With Introduction by Wyeth Wasserman

  2. Welcome • If you encounter any technical difficulties during the webinar, type a report using the chat option • Slide presentation ~25 min • Compile Questions as they are submitted and answer them during the final Q&A/discussion period • During the discussion session, we’ll allow audience speaking

  3. Topics • PAZAR Overview • Data Retrieval Through Web Interface • Data Files and Formats • PAZAR Application Programming Interface (API) • Q&A

  4. Topics will increase in complexity as webinar progresses • Data file formats will be presented in order of complexity, beginning with the simplest • PAZAR API will be the most technical topic presented today and is geared toward those with programming knowledge 4

  5. www.pazar.info • Software framework for the construction and maintenance of regulatory sequence data annotation • Allows multiple boutique databases to function independently within a larger system • Public repository for regulatory data • Each group manages its own deposit and distribution of data • Envisioned as tool for capturing deep experimental annotation • Species, cell line, treatment

  6. Browsing Data on PAZAR Link to project details

  7. Project Information

  8. Gene View Link to sequence details

  9. Sequence Information

  10. TF View

  11. Data File Formats

  12. Data Files available for Download

  13. TF – Target Gene Format • Provides listing of TFs and the genes that they putatively regulate • In some cases, the gene is the most proximal to the TF binding site - especially true for ChIP-Seq regulatory sequences. • PubMed ID and Analysis method provided as interaction evidence when available • Files automatically exported for all public projects • Updated weekly

  14. TF – Target Gene File Example Gene End Coordinate Chromosome Gene Start Coordinate PAZAR Gene ID Ensembl Gene Accession PAZAR TF ID TF Name TF0001078 E2F4_HUMAN GS00121862 ENSG00000187634 1 860260 879955 Homo sapiens E2F4_Lee 21247883 PROTEIN BINDING ASSAY::CHROMATIN IMMUNOPRECIPITATION (CHIP) Species Analysis Method Project Name Evidence PMID

  15. ChIP-Seq Peak Format • For users who are only interested in ChIP-Seq peak data • Provides peak information in a simple delimited format that is easy to work with • Files will be exported for public projects containing ChIP-Seq data and updated weekly

  16. ChIP-Seq Peak File Example chr1 915920 916350 916127 195.45 MAXHEIGHT ENSG00000187961 E2F4 Homo sapiens 21258399 Human Lymphoblastoid cells Peak start coordinate Peak max coordinate Chromosome TF Name Peak end coordinate Score Score type TF ID Species PMID Cell or Tissue

  17. PAZAR GFF Format • GFF format describes genes and other features associated with DNA, RNA and Protein sequences • The PAZAR GFF format is intended to represent simple annotations • One annotation record per line, one annotation for one sequence • Not as comprehensive as XML files; represents a subset of total data, but may be easier for some people to work with • Projects containing only artificial sequences (eg. jaspar_core) follow slightly different format. Refer to GFF format documentation for details. • Files automatically exported for all public projects • Updated weekly

  18. PAZAR GFF File Example chr12 E2F4_Lee RS02930218275222582752317 . + . sequence="CA…AT";db_seqinfo="ENSEMBL:60_37E";db_geneinfo="ENSEMBL:ENSG00000127720:C12ORF26";species="HOMO SAPIENS"; db_tfinfo="EnsEMBL_transcript:ENST00000394351:E2F4_HUMAN";analysis_name="ANALYSIS 1";analysis_comment="0";cell_type="HUMAN LYMPHOBLASTOID (GM06990) CELLS:HOMO SAPIENS";pmid="21258399";method="PROTEIN BINDING ASSAY::CHROMATIN IMMUNOPRECIPITATION (CHIP)";evidence="CURATED" Sequence start coordinate Sequence end coordinate Strand Chromosome Project Name PAZAR Feature ID Score Frame Mandatory Attributes Optional Attributes

  19. PAZAR XML Format • Extensible Markup Language (XML) is a markup language that defines a set of rules for encoding documents • PAZAR XML schema defined for capturing data and relationships • Comprehensive and flexible enough to capture many types of data • Files automatically exported for all public projects • Updated weekly

  20. Sample PAZAR XML File <reg_seq pazar_id="rs_0022" quality="TESTED" sequence="CGGGCTCTCCGACCCACGGGTCACTTTTGACAGCTGGCCTGAGTCCTGCCTGGTGGAAACCCCTCCTGGGAGGCTGGAGCCAGCACCAGGGCCCACGTGTGCTT CACCTTGAAGCCTGAGGACACAGACTCTCCGGCAATCACATAGCCCATGTTGAGGACGCTGCCTTCAATGGAGCACGTGATCATGGACGCCACGCCAGTGCCCATGAGGGTGA GGGTGAGCGTGCCTCTCTTGGTGATGATGTCCAG" tfbs_name=""> …. <peak maxcoord="1857289"/> </reg_seq> <funct_tf funct_tf_name=“E2F4_HUMAN" pazar_id="fu_001"> <tf_unit pazar_id="tu_0001" tf_id="tf_001"/> </funct_tf> <interaction pazar_id="in_00063" quantitative="299.77" scale="MAXHEIGHT"/> • Understanding of schema and parsing work required to extract ChIP-Seq data

  21. PAZAR API Overview • Application Programming Interface (API) facilitates programmatic retrieval of data contained in 'Published' or 'Open' projects as well as user's own restricted projects. • Provides a mechanism for automating bulk data retrieval in a customized fashion • Provides Methods to make it easier to work with data once it has been retrieved • Object – oriented -> data types within the system can be mirrored as objects in code • Uses the perl programming language • Uses SOAP communication protocol for transferring data

  22. SOAP • Simple Object Access Protocol (SOAP) is a protocol for exchanging structured information between networked computers. It relies on Extensible Markup Language (XML) for its message format. • Communication done using http as transport layer, can be used on any network that permits web browsing • Client computer sends requests to server, which performs functions to retrieve data from database and return it to client • Code to perform functions resides on the server, so client only needs to send requests in order to receive data Simple Object Access Protocol (SOAP) is a protocol for exchanging structured information between networked computers. It relies on Extensible Markup Language (XML) for its message format. - Communication done over http, can be used on any network that permits web browsing

  23. Benefits of using SOAP • Users do not have to worry about installing the API code on their computer • Updates to newer API releases involve minimal effort • Can be used across firewalls where only web browsing is permitted • Transparent – users don't have to learn new syntax or change the way they code • Language independent, but yet to be further developed and tested with programming languages other than perl in mind • Data privacy can be managed by the PAZAR team since authentication is done on the server side

  24. Data Privacy • Access to data through API same as through website. PAZAR username and password must be supplied to retrieve data from personal restricted projects. • Authentication is performed on PAZAR server

  25. PAZAR API Classes pazar class - handles authentication and contains general methods for retrieving data and creating instance objects of other classes - a PAZAR object must always be created first. It is supplied to all methods in other classes. pazar::project - handles project information pazar::dbsource - handles information source data pazar::gene - handles gene information pazar::reg_seq - handles regulatory sequence information pazar::tf - Transcription Factor meta information and general methods for retrieving TF-related information pazar::tf::tfcomplex - handles Transcription Factor complex information pazar::tf::subunit - handles Transcription Factor subunit information pazar::tf::target - handles Transcription Factor target (regulatory sequence, artificial sequence or binding site matrix) information pazar::transcript - handles transcript information pazar::tsr - handles transcription start region information

  26. PAZAR API Documentation www.pazar.info/apidocs

  27. API Setup 1. Install perl library SOAP::Lite v 0.60a by Paul Kulchenko . • Later versions of SOAP::Lite maintained by different author and not compatible with the PAZAR API. • Can be downloaded from link in the PAZAR API user guide at http://www.pazar.info/apidocs/userguide.html • Also available for download from CPAN at http://search.cpan.org/~byrne/SOAP-Lite-0.60a • SOAP::Lite installation should follow standard procedures 2. Include the following at the top of your script, before any code that makes use of the API use SOAP::Lite +autodispatch => uri => 'http://www.pazar.info/pazar', proxy => 'http://www.pazar.info/cgi-bin/API0.01/pazarserv.cgi'; • Any code that follows will automatically make use of PAZAR API modules via SOAP; no additional modules need to be installed on the client side. • API0.01 may be replaced by a newer release number when available (eg. API0.02), to use the newer API • Older API releases will continue to be in service after newer releases have been made available

  28. Sample Perl Code Using PAZAR API #!/usr/bin/perl use SOAP::Lite +autodispatch => uri => 'http://www.pazar.info/pazar', proxy => 'http://www.pazar.info/cgi-bin/API0.01/pazarserv.cgi'; # change yourusername@domain.ca and yourpass to values for your own PAZAR account my $pazar = new pazar(-pazar_user=>'yourusername@domain.ca', -pazar_pass=>'yourpass'); my $proj = pazar::project::get_by_name(‘Demo',$pazar); print $proj -> status ."\n"; print $proj -> id ."\n"; print $proj -> project_name ."\n"; print $proj -> description ."\n"; my $project_name = $proj -> project_name; my $project_num=$proj->id; my @funct_tfs = $pazar->get_all_complex_ids($project_num); print "num tf complexes: ".scalar(@funct_tfs)."\n"; Setup

  29. Future PAZAR API Development • API testing with other programming languages such as Java and Python • Expansion of variety of classes and methods offered • Further support for ChIP-Seq data handling • Update and import of data

  30. Recap Browsing through current data online • Web interface Data Files Available for download • TF- target Gene list • ChIP-Seq peak files • GFF • XML (all data) Bulk retrieval of most current data in customized way through programmatic approach • PAZAR API

  31. Q&A • Please take a moment to type PAZAR-related questions/comments into the Chat box. • The questions will be answered shortly.

More Related