Persea Americana and Persea Pseudocarolinensis

1. Persea Americana and Persea Pseudocarolinensis By Jacky Luo Vincent Lum Jackie Xie

2. Persea Americana Location Avocados will grow in shade and between buildings, but are productive only in full sun. The roots are highly competitive and will choke out nearby plants.

3. Facts Avocado leaves are alternate, glossy, elliptic and dark green with paler veins. They normally remain on the tree for 2 to 3 years. Due to recalcitrant nature of the seeds, they have a short viable life, can not be dried well and can not withstand low temperatures.

4. This is a fruit cluster of three avocado in a persea americana tree.

5. Persea Pseudocarolinensis Location Fossil Location In private Property in Clarkia, Idaho Clarkia Fossil Bowl Racetrack, Clarkia, Idaho

6. Pseudocarolinensis Photo of the Persea Pseudocarolinensis extracted in Clarkia, Idaho fossil site

7. Svante Pääbo He said that fossil older than one hundred thousand years to fifty thousand years old won’t be able to have its DNA extracted because over time outside radiation and water would destroy the DNA.

8. The other group A group of scientist wrote for the American Journal of Botany in 2004 saying that it was possible to extract DNA from the miocene period.

9. RBCL GENE Persea Americana 1 aaaggaacta aagcaagtgt tggattcaaa gctggtgtta aagattacaa attgacttat 61 tatactcctg actatgaaac caaaagtact gatattttgg cagcatttcg agtaactcct 121 caacccggag ttccacctga ggaagcaggg gctgcggtag ctgccgaatc ttctactggt 181 acatggacaa ctgtgtggac cgatggactt accagccttg atcgttacaa aggacgatgc 241 taccacatcg agcccgttgc tggggaggaa agtcaattta ttgcctatgt agcttaccct 301 ttagaccttt ttgaagaagg ttctgttacg aacatgttta cttctattgt gggtaatgta 361 tttgggttca aagctctacg agctctacgt ctggaggatc tgcgaattcc tcctgcttat 421 tccaaaactt tccaaggccc gccccatggc atccaagttg agagagataa attgaacaag 481 tatggtcgtc ccctattggg atgtactatt aaaccaaaat tggggttatc cgccaagaac 541 tacggtagag cggtttatga atgtctccgt ggtggacttg attttaccaa ggatgatgag 601 aacgtgaact cccaaccatt tatgcgttgg agagaccgtt tcttattttg tgccgaagca 661 atttataaat cgcaggccga aacaggtgaa atcaaaggac attacttgaa tgctactgca 721 ggtaaac Persea PseudoCarolinensis 1 aaaggacatt acttgaatgc tactgcaggt acatgcgaag aaatgatcaa aagggccgta 61 tttgccagag aattgggagt tcctatcgta atgcatgact atttaacggg gggattcact 121 gcaaatacta gcttggctca ttattgccgg gacaacggcc tacttcttca catccatcgc 181 gcaatgcatg cagttattga tagacagaag aatcatggta tgcactttcg cgtactggct 241 aaagcgttac gtatgtctgg tggagatcat attcacgctg gtaccgtagt aggtaaacta 301 gaaggggaac gggacatcac tttgggtttt gttgatttac tacgtgatga ttttattgaa 361 aaagaccgaa gtcgcggtat ttatttcact caagattggg tctctatgcc aggtgttctg 421 cccgtggctt cagggggtat tcacgtttgg catatgcctg ccctgaccga gatctttggg 481 gatgattccg tactacagtt cggtggagga actttaggac acccttgggg aaacgcacct 541 cgtgcagtag ctaatcgggt ggctttagaa gcgtgtgtac aagctcgtaa tgagggacgt 601 gatcttgctc gtgaaggtaa tgaaattatc cgtgaagctt ccaaatggag ccctgagcta 661 gctgcggctt gtgagatatg gaaggagatc aaattcgaa

10. Primers Persea Americana LEFT PRIMER tgcgaattcctcctgcttat RIGHT PRIMER atcaagtccaccacggagac LEFT PRIMER tgcgaattcctcctgcttat RIGHT PRIMER agtccaccacggagacattc LEFT PRIMER aggatctgcgaattcctcct RIGHT PRIMER ccgtagttcttggcggataa LEFT PRIMER gacaactgtgtggaccgatg RIGHT PRIMER gaattcgcagatcctccaga Persea PseudoCarolinensis LEFT PRIMER gaccgaagtcgcggtattta RIGHT PRIMER gcaagatcacgtccctcatt LEFT PRIMER ctgcaggtacatgcgaagaa RIGHT PRIMER gtacgcgaaagtgcatacca LEFT PRIMER tctttggggatgattccgta RIGHT PRIMER ctagctcagggctccatttg LEFT PRIMER tgccagagaattgggagttc RIGHT PRIMER ccagtacgcgaaagtgcata

11. DNA Extraction Of Persea Americana Steps 1. grind up leaf until it becomes a pasty like substance to break down cell walls 2. add some edwards buffer to destroy cell membrane 3. vortex and centrifuge it a few times to get all the junk not needed to the bottom and to get a supernatant

12. Steps continued 4. Pour out the supernatant which contains DNA and other stuff not needed into another test tube 5. Add isopropanol to the supernatant to separate the DNA from rest of the solution 6. Vortex and centrifuge to get the DNA to the bottom 7. let it dry out for a few minutes then take the supernatant and leave the DNA on the bottom behind

13. Making Agarose Gel 1. Mix 0.6%-2% agarose powder into a buffer like TE buffer. The amount of powder used varies based on what you are testing. 2. Put the mixture into a microwave for less than 1 minute to get the powder melted into with the buffer. 3. Let the gel cool down until it isn't that hot. 4. Pour the liquid into a gel tray without stopping until the gel isn't to thin or to thick. 5. Let the gel solidify and store it in a refrigerator to keep it from shriveling up.

14. Running The Gel

15. REFERENCES http://www.454genomics.net/downloads/news-events/geneticanalysisfromancientdna.pdf http://www.dnalc.org/view/15152-Isolating-ancient-DNA-Svante-Paabo.html http://www.avocadosource.com/CAS_Yearbooks/CAS_52_1968/CAS_1968_PG_029-034.pdf http://www.amjbot.org/cgi/reprint/91/4/615.pdf http://www.ncbi.nlm.nih.gov/ http://frodo.wi.mit.edu/primer3/ http://www.mines.uidaho.edu/~tertiary/ http://www.molecularstation.com/molecular-biology-techniques/gel-electrophoresis/ http://www.crfg.org/pubs/ff/avocado.html http://www.hort.purdue.edu/newcrop/morton/avocado_ars.html