710 likes | 889 Vues
Mistérios Moleculares da Vassoura de Bruxa. Gonçalo Guimarães Pereira UNICAMP Salvador - Bahia 23/04/04. Basis. Organism. Gene. Genomics Discover that the Organism Y has a gene similar to the Gene A found in the Organism X. Biochemistry Discover the function of the Gene A
E N D
Mistérios Moleculares da Vassoura de Bruxa Gonçalo Guimarães Pereira UNICAMP Salvador - Bahia 23/04/04
Basis Organism Gene Genomics Discover that the Organism Y has a gene similar to the Gene A found in the Organism X Biochemistry Discover the function of the Gene A in the Organism X A(Y) ~ A(X)
Sequencing Bioinformatics Expression Analysis Genomics Tools Organism Raw Sequence Putative Genes Cellular Program
Genomics Mission Genomics X Trial and Error Hypothesis for Targets Definition
3 Mb ATG CT Genome Xylella fastidiosa Bioinformatics ATGGGCCTTTG CTTTGCCCCCAAA TGCCCCCAAAAGGGGG AAAGGGGGAAAAG 50 kb ATGGGCCTTTGCCCCCAAAAGGGGGAAAAG AGGGGGAAAAGTTTGC CCTGGGGGATGGGCCTTTGC 50 kb Identification of genes 1 a 2 kb Sequencing
Virtual Metabolism BLAST
and more.... Xylella fastidiosa - Pierce's Disease Strain: Grape phytopathogen Leifsonia xyli subsp. xyli (Sugarcane phytopathogen) Leptospira Eucalyptus Coffee Caw
Agriculture improvement Human diseases Herbaspirillum seropedicae Leishmania chagasi Gluconacetobacter diazotrophicus Schistosoma mansoni Eucalyptus Trypanossoma cruzi Paracoccidioides brasiliensis Regional Genomes Phytopathogen Crinipellis perniciosa
Samba, football and ..... Genomics
Practical Results ????????????
Cacau Production in Brazil Thousand Tons
Cacau Income U$ Billion
U$ Million Witche’s Broom Loses 100.000 ha Forest U$ 1.380.000.000,00 300.000 jobs
Goals of the Witch's Broom Genome Project Pragmatic 1. Build a Genomics Network at the State of Bahia to face biological problems 2. Create the basis to understand the Witch's Broom disease, indicating possible solutions
Symptoms - 1 Fotos - João de Cássia - CEPEC-CEPLAC
Symptoms - 2 Fotos - João de Cássia - CEPEC-CEPLAC
Symptoms - 3 Fotos - João de Cássia - CEPEC-CEPLAC
Crinipellis perniciosa Fotos - João de Cássia - CEPEC-CEPLAC
Meiose Differentiation Life Cycle
ATG CT CT ATG ATG CT CT ATG ATG (?) CT Complexity X Strategy Prokaryotes ~ 3 Mb 1G/1Kb Eukaryotes Fungi - Saccharomyces cerevisiae ~ 20 Mb 1G/2Kb Human ~3.000 Mb 1G/75 Kb
Sequencing X Coverage Contigs Singlets
Gaps X Coverage 303 >1000bp 2X 1X
20 Kb 3 reads Sequencing Strategy Genomic Shotgun 40 reads: 500 bp/each
Libraries Libraries Sequences Sequences Bahia Genomics Network DNA Coordination UNICAMP UESC CEPLAC CENARGEN UNICAMP UFBA-Farmácia UFBA- IB UEFS UCSAL Databank Bioinformática UNICAMP/UESC Interface Cacau Research Community
Chips Molecular Mapping Inactivation Structural Analysis Data Treatment: “on going” annotation Shotgun Assembling BACs Blast Complete Genome Pre-Annotated Read Metabolic Maps Local clustering ORFs Representative Read Proteomics
Geração Controle Análise Bioinformatics Services Serviços Sequence submission Nomenclature Nomenclature edition Submission test Administrative services Keyword search in Blast files Anotation (test) Annotated seeds Contigs progress Sequence pattern search Blast against C. perniciosa Blast results - All reads Sequence analysis tools (Emboss) Access control Access control (graph) Library Control Strain Labs productivity Labs productivity graphs Labs productivity graphs (cumulative) Quality Bug reports Gene Project
Selection: File, Keyword, Blast, Seq. pattern, all Assembling: PPC, Saturation Blast of consensus Analysis: ORF finder, Comparison, Prediction Gene Project* Data bank: Blasted reads Selected reads Assembled Reads Consensus Annotated Gene *Carazzolle, MF, Digiampietri, L, Araújo, MRS, Formighieri, EF, Tsukumo, F & Pereira, GAG
Nc, Sc, Sp, Cp Nc, Sc, Cp Glucose- 6-phosphate 5. 3. 1. 9 Fructose-6- phosphate Only Nc Glutamine None 2. 6. 1. 16 Glutamate 3. 2. 1. - 2. 7. 1. 1 Glucosaminide Glucosamine Glucosamine-6- phosphate ATP ADP 2. 3. 1. 4 3. 5. 1. 25 AcetylCoA CoA 5. 4. 2. 3 N-Acetylglicosamine-1- phosphate N-Acetylglucosamine-6-hosphate UTP 3. 2. 1. 132 ADP 2. 7. 7. 23 2. 7. 1. 59 pyrophosphate ATP UDP-N-Acetilglicosamina N-Acetylglucosamine 2. 4. 1. 16 UDP 3. 2. 1. 52 3. 2. 1. 14 Chitobiose Chitosan CHITIN 3. 5. 1. 41 Chitin Metabolism Goes-Neto, Priminho, et. Al UEFS
Control Infected Phases DAI 1 3 2 7 3 14 4 21 5 35 6 61 7 130 Biochemistry of Infection - 1 Ph.D. Work: Leandra Scarpari; Supervisor: Gonçalo Pereira; Co-supervisors: Paulo Mazzafera e Alan Pomella Acknowledge: Almirante Cacau
Açucar Solúvel Amido Component > Control > Inoculated No Diference Açucares - Solúveis totais XXX - Sacarose XXX - Amido XXX - Hemicelulose XXX - Açúcares redutores XXX - Celulose XXX - Pectinas XXX Aminoácidos Quantitativo XXX Qualitativo *** ASP, GLUASN Fenóis totais XXX Taninos XXX Nitrato XXX Flavonóides totais XXX Clorofilas e carotenóides XXX Hormônios Etileno XXX Auxina Citocinina Hemicelulose AA - Total AA - Inoculado AA - Controle Flavonóides Totais Clorofila Total Biochemistry of Infection - 2
C Asparagina Acido Glutâmico I Biochemistry of Infection - 3 The infection triggers the plant Programmed Cell Death - PCD
C S L 1. S. cerevisiae + H. wingei (Bio Rad) 2. CP02 (Biótipo C) 3. CP09 (Biótipo C) 4. FA42 (Biótipo C) 5. Ilhéus (Biótipo C) 6. FA104 (Biótipo S) 7. SCFT (Biótipo L) 8. FA322 (Biótipo L) 9. S. pombe 10. S. cerevisiae Molecular Features 1 2 3 4 5 6 7 8 9 10 Rincones, J, Meinhardt, L, Vidal, B & Pereira, GAG
5.2 4.6 3.1 3.5(3) 2.8(2) Genome Size 29 Mb
I II Amazônicos II Genome Variability Bahia Probably only two clones of C. perniciosa have been introduced in Bahia
Bahia A1-R Bahia A1 I I II II 3054 bp 2036 bp 1636 bp 1018 bp 517 bp Telomeric PCR Meinhardt, L, Rincones, J. & Pereira, GAG
Rondônia???? Amazônicos
Genetic Solution Creation of strict sanitary barriers between Amazonia and Bahia
M L S U 1 2 3 4 5 6 P B S C C L Reverse Trancriptase 394 S C C L S C C L Restless-like Impala-like Class I Super-family Gypsy/Ty3 Transposons Marisa Queiroz - UFV
Meioses Variability Dynamics 1. Cromossomal variations can be immediately fixed 2. Variability may raise by mutation and transposons 3. Why we do not see higher variability in Bahia???? Homobasidiomycete ??? Sexual Phase
Kalilo - like Senescence 109 kb
Senescence Waves Hugo
Alternative Oxidase C. perniciosa Alternative Oxidase
Recommendations 1. Strobirulin based fungicides are ineffective at the field 2. Inhibition of mitochondria may be effective to control the disease and could be achieved by combining strobirulin and Sham analogues