230 likes | 343 Vues
Allelic Variation in Biomphalaria glabrata. Jordan Peterschmidt Dr. Michael Blouin Zoology Department. Background. Biomphalaria glabrata Vector for Schistosoma Freshwater snail South America and Africa 1316R inbred lines. Background. Schistosomiasis Chronic, tropical disease
E N D
Allelic Variation in Biomphalariaglabrata Jordan Peterschmidt Dr. Michael Blouin Zoology Department
Background • Biomphalaria glabrata • Vector for Schistosoma • Freshwater snail • South America and Africa • 1316R inbred lines
Background • Schistosomiasis • Chronic, tropical disease • 300,000 deaths per year • Infects over 2 million • Second greatest socioeconomically devastating parasitic disease • Effects
Resistance in snails • Cu/Zn Superoxide dismutase (SOD1) • 2O2− + 2H+ → O2 + H2O2 • Blood cells: Hemocytes • Encapsulate and respiratory burst
Allelic variation • Three alleles in population: A, B, and C
100 90 80 70 60 50 40 30 20 10 0 • Allelic variation • Resistance C < A < B % individuals not infected Genotype
Allelic variation • Three alleles in population: A, B, and C • B allele over expressed • Known to differ in size of first intron
B allele ~4kbp • Allelic variation 1stintron ~2kbp A and C allele ~6kbp 1stintron ~4kbp ~2kbp
B allele ~4kbp • Allelic variation • Complete sequence of B allele known • A and C incomplete 1stintron ~2kbp A and C allele ~6kbp 1stintron ~4kbp ~2kbp
Goal • Understand the functional differences between alleles by: • Completing full exon and intron sequence of A and C alleles at SOD1 locus
Hypothesis • Alleles differ in: • Exon sequence and/or • Regulating properties of first intron sequence in A and C alleles
Methods • DNA extraction • Genotype individual • Identified by indel within fourth intron
Indel • Insertion/deletion # base pairs A B C B C
Methods • DNA extraction from head-foot • Genotyped individuals • Identified by insertion within fourth intron • Designed primers from known B sequence • PCR and long PCR • Sequence and align PCR products
Results • Sequenced entire A and C alleles at SOD1 locus • First intron incomplete • Unable to amplify first intron in C allele
A allele ex1 in1 ex2 in2 ex3 in3 ex4 n4 ex5 Diagram Key Hole in contig Single strand Double strand
C allele ex1 in1 ex2 in2 ex3 in3 ex4 in4 ex5 Diagram Key Hole in contig Single strand Double strand
Coding sequence EXON 1: B ATGGTCAAAGCAGTTTGCGTTTTAAGTCCAGGCTCTGGAACTGGCATTACTGGAACCATTACTTTTACCCAGGAA A .....................................C..................................... C .....................................C..................................... M V K A V C V L S P G S G T G I T G T I T F T Q E Glycine to Alalnine EXON 2: B AAAGCAGGGGACTGTACAGTGGTTTCTGGTAAAGTATCAGGCCTTGCTCCAGGTAATCATGGATTTCATATCCATCAATTTGGTGACTACTCAAATG A ................................................................................................. C ........A..............................................................T......................... K A G D C T V V S G K V S G L A P G N H G F H I H Q F G D Y S N EXON 3: B GGGTGTATTAGTGCAGGTGCTCACTTTAACCCAGCAAACAAGAATCATGGAGGCCCTTGTGATACAGAAAG A ..C..............C..................................................... C ..C..............C..................................................... G C I S A G A H F N P A N K N H G G P C D T E EXON 4: B AGACATGTTGGTGATTTAGGTAACATTGTGGCTGGTGATGATGGTGTTGCTGATGTTAGTATCAAAGATCAACAAATTTCTTTGATTGGAGAAAATTCTATCATTGGTCGCAGCTTAGTG A ........................................................................................................................ C .....................................................C..........................A....................................... R H V G D L G N I V A G D D G V A D V S I K D Q Q I S L I G E N S I I G R S L V EXON 5: B GTGCATGATAAAGAGGATGATCTCGGCAAGGGAGGCAATGAAGAAAGTCTTAAAACAGGAAATGCTGGACCTCGCTTAGCTTGTGGTGTCATTGGTATCACTGTGTAA A ................................................................................. C ................................................................................. V H D K E D D L G K G G N E E S L K T G N A G P R L A C G V I G I T V V
Discussion • Exons • Introns • Expect many differences • Greatest difference in first intron • Difficulty amplifying first intron in C allele
Future work • Complete first intron • Understand full extent of variation • Analyze first intron • Examine for transcription regulating factors that affect gene expression
Acknowledgements • Dr. Michael Blouin • Kaitlin Bonner • HHMI • URISC