1 / 22

Allelic Variation in Biomphalaria glabrata

Allelic Variation in Biomphalaria glabrata. Jordan Peterschmidt Dr. Michael Blouin Zoology Department. Background. Biomphalaria glabrata Vector for Schistosoma Freshwater snail South America and Africa 1316R inbred lines. Background. Schistosomiasis Chronic, tropical disease

elsa
Télécharger la présentation

Allelic Variation in Biomphalaria glabrata

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Allelic Variation in Biomphalariaglabrata Jordan Peterschmidt Dr. Michael Blouin Zoology Department

  2. Background • Biomphalaria glabrata • Vector for Schistosoma • Freshwater snail • South America and Africa • 1316R inbred lines

  3. Background • Schistosomiasis • Chronic, tropical disease • 300,000 deaths per year • Infects over 2 million • Second greatest socioeconomically devastating parasitic disease • Effects

  4. Schistosoma mansoni

  5. Resistance in snails • Cu/Zn Superoxide dismutase (SOD1) • 2O2− + 2H+ → O2 + H2O2 • Blood cells: Hemocytes • Encapsulate and respiratory burst

  6. Allelic variation • Three alleles in population: A, B, and C

  7. 100 90 80 70 60 50 40 30 20 10 0 • Allelic variation • Resistance C < A < B % individuals not infected Genotype

  8. Allelic variation • Three alleles in population: A, B, and C • B allele over expressed • Known to differ in size of first intron

  9. B allele ~4kbp • Allelic variation 1stintron ~2kbp A and C allele ~6kbp 1stintron ~4kbp ~2kbp

  10. B allele ~4kbp • Allelic variation • Complete sequence of B allele known • A and C incomplete 1stintron ~2kbp A and C allele ~6kbp 1stintron ~4kbp ~2kbp

  11. Goal • Understand the functional differences between alleles by: • Completing full exon and intron sequence of A and C alleles at SOD1 locus

  12. Hypothesis • Alleles differ in: • Exon sequence and/or • Regulating properties of first intron sequence in A and C alleles

  13. Methods • DNA extraction • Genotype individual • Identified by indel within fourth intron

  14. Indel • Insertion/deletion # base pairs A B C B C

  15. Methods • DNA extraction from head-foot • Genotyped individuals • Identified by insertion within fourth intron • Designed primers from known B sequence • PCR and long PCR • Sequence and align PCR products

  16. Results • Sequenced entire A and C alleles at SOD1 locus • First intron incomplete • Unable to amplify first intron in C allele

  17. A allele ex1 in1 ex2 in2 ex3 in3 ex4 n4 ex5 Diagram Key Hole in contig Single strand Double strand

  18. C allele ex1 in1 ex2 in2 ex3 in3 ex4 in4 ex5 Diagram Key Hole in contig Single strand Double strand

  19. Coding sequence EXON 1: B ATGGTCAAAGCAGTTTGCGTTTTAAGTCCAGGCTCTGGAACTGGCATTACTGGAACCATTACTTTTACCCAGGAA A .....................................C..................................... C .....................................C..................................... M V K A V C V L S P G S G T G I T G T I T F T Q E Glycine to Alalnine EXON 2: B AAAGCAGGGGACTGTACAGTGGTTTCTGGTAAAGTATCAGGCCTTGCTCCAGGTAATCATGGATTTCATATCCATCAATTTGGTGACTACTCAAATG A ................................................................................................. C ........A..............................................................T......................... K A G D C T V V S G K V S G L A P G N H G F H I H Q F G D Y S N EXON 3: B GGGTGTATTAGTGCAGGTGCTCACTTTAACCCAGCAAACAAGAATCATGGAGGCCCTTGTGATACAGAAAG A ..C..............C..................................................... C ..C..............C..................................................... G C I S A G A H F N P A N K N H G G P C D T E EXON 4: B AGACATGTTGGTGATTTAGGTAACATTGTGGCTGGTGATGATGGTGTTGCTGATGTTAGTATCAAAGATCAACAAATTTCTTTGATTGGAGAAAATTCTATCATTGGTCGCAGCTTAGTG A ........................................................................................................................ C .....................................................C..........................A....................................... R H V G D L G N I V A G D D G V A D V S I K D Q Q I S L I G E N S I I G R S L V EXON 5: B GTGCATGATAAAGAGGATGATCTCGGCAAGGGAGGCAATGAAGAAAGTCTTAAAACAGGAAATGCTGGACCTCGCTTAGCTTGTGGTGTCATTGGTATCACTGTGTAA A ................................................................................. C ................................................................................. V H D K E D D L G K G G N E E S L K T G N A G P R L A C G V I G I T V V

  20. Discussion • Exons • Introns • Expect many differences • Greatest difference in first intron • Difficulty amplifying first intron in C allele

  21. Future work • Complete first intron • Understand full extent of variation • Analyze first intron • Examine for transcription regulating factors that affect gene expression

  22. Acknowledgements • Dr. Michael Blouin • Kaitlin Bonner • HHMI • URISC

More Related