Supplemental figures Fig S1

Oct 24, 2014

10 likes | 136 Vues

Supplemental figures Fig S1. Fig S2.

Share Presentation

Embed Code

Link

fig s2
fig s1
supplemental figures

fisseha

Télécharger la présentation

Supplemental figures Fig S1

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

Supplemental figures Fig S1 Fig S2

Fig S1

Overexpression of Ezh2 correlates with higher tumor proliferation and aggressiveness in malignant lymphomas Virchows Archiv

224 views • 5 slides

Supplemental data Fig. S1

Supplemental data Fig. S1.

123 views • 4 slides

Fig. S1

Fig. S1. Fig. S1 Representative histologic image of CCl 4 -induced cirrhotic liver. Azan-Mallory staining; original magnification x50. Fig. S2. Cirrhosis. Normal. IL-1 b. IL-8. TNF- a. TGF- b. PRL21. Fig. S2 Cytokine expression levels in the liver of ci rrhotic rats.

162 views • 2 slides

Fig. S1

a. b. 2.5. 7. 6. 2.0. 5. 1.5. 4. c ell mortality ratio (%). r elative cell number. 3. 1.0. 2. 0 .5. 1. 0. 0. CN 0.1 0.5 1 5 10 20 30. Sal ( m M ). CN 0.1 0.5 1 5 10 20 30. Sal ( m M ). c. 8. **. 6. Alizarin red S staining

159 views • 4 slides

Fig S1

Fig S1.

128 views • 3 slides

Supplemental Fig. S1

extracellular (P=0.000) cell wall (P=0.000) ribosome (P=0.001) ER (P=0.294) golgi apparatus (P=0.005) plasma membrane (P=0.000) mitochondria (P=0.000) cytosol (P=0.553) other cellular components (P=0.000) nucleus (P=0.000) other membranes (P=0.970) plastid (P=0.000)

249 views • 12 slides

Fig S1

Fig S1. A). B). pET-opTAL. pET -TAL. M 3 4. kDa. kDa. M 1 2. 95. 95. 72. 72. 55. TAL. opTAL. 55. 43. 43. *. 34. 34. Fig S2. A). B). pET-opT5. pET-T5. M 3 4. M 1 2. kDa. kDa. 95. 95. 72. 72. Sam5(59kDa). Sam5 (59kDa). 55.

156 views • 4 slides

Fig S1

Fig S1. b. a. Cortex. Cortex. 20. 20. *. 16. 16. *. 12. 12. MAGL (fmol/mg/min). FAAH (fmol/mg/min). *. 8. 8. *. 0 mg/kg. *. 4. 4. 0 mg/kg. 1 mg/kg. 1 mg/kg. 0. 0. 0 1h 1d 2d 3d 10d. 0 1h 1d 2d 3d 10d. Time relative to injection.

166 views • 6 slides

Fig. S1

a. b. Highways. 0. 20. 40. Other roads. Urban area. Kilometers. Fig. S1. 0. 0. 0. 0. 0. 0. 0. 0. 20. 20. 20. 20. 20. 20. 20. 20. 40. 40. 40. 40. 40. 40. 40. 40. Kilometers. Kilometers. Kilometers. Kilometers. Kilometers. Kilometers. Kilometers. Kilometers.

174 views • 5 slides

Fig. S1

3.74%. 3.54%. 45.60%. 41.22%. 3.54%. 3.74%. 47.21%. 43.34%. 4.35%. 5.15%. 2.01%. 3.00%. 4.35%. 5.15%. 33.84%. 34.73%. ROS dye added after trypsinization. ROS dye added before trypsinization. Percentage of ethidium fluorescence positive cells (O 2 .- production). Control. No GP.

244 views • 11 slides

Supplemental Fig. S1

Supplemental Fig. S1. a). b). PsAPY1 (AB071369) 1:MEFLIKLIT-FLLFSMPAITSSQYLGNNLLTSRKIFLKQEEISSYAVVFDAGSTGSRIHV 59 MtAPY1;1 (AY180377) 1:MEFLITLITTVLLLLMPAITSSQYLGNNLLTNRKIFQKQETISSYAVVFDAGSTGSRIHV 60 ***** *** ** **************** **** *** *******************

113 views • 3 slides

Supplemental FIG. S1

Supplemental FIG. S1. 1387 CAGUGCUUUAACUCUGUGCA UCACACUUGUCCUUUAAAUG 1427 GAGACUGUAAGCUUUUAUGA ACUUUUUUUACUUGGACACC 1467 ACUUUUACACAAAGUAUUUU GAAACAAAAGGCUAUAGGAA 1507 ACAUGAAAAGGUCAAAUGAU CAUUAUGCUGCUAUGGAGGA 1547 UGCUACUUGAUGGAGAUCAG CUGCUCGGGGCCAAGAAAAA

81 views • 1 slides

Fig S1

Figure S1: 5T4 expression in B cell development . Adapted from microarray data published online by van Zelm et al http://franklin.et.tudelft.nl/#bcell [11]. Fig S1. (i). (ii). (ii). C. Figure S2 Expression of 5T4 by B-ALL relapse patients blasts

218 views • 7 slides

Supplemental Fig. S1 Awano et al

*. 0.10. D272NRNase R. 0.08. D280NRNase R. D. CsdA-. C. 0.06. Fraction unwound. 0.04. 0.02. 0.00. 0. 5. 10. 15. 20. 25. Time (min). Supplemental Fig. S1 Awano et al. A. CsdA- D C. RNase R-WT. D272NRNase R. D278NRNase R. D280NRNase R. Time (min).

108 views • 2 slides

Fig. S1

Fig. S1. WT Tg. Hsp90 Hsp70/72 HSPA12B * Hsp60 Hsp25  BC  -Tubulin. HSPA12B. PCAM-1. Merge. HSPA12B. PCAM-1. Merge. Fig.S2A. Fig.S2B. WT Tg. Baseline. 1 week post-sham. 4 weeks post-sham. Fig. S3. WT Tg. Fig. S4.

250 views • 11 slides

Fig. S1

Si. Mg. Ca. S. Fe. A. B. Fig. S1. Fig. S2. a. 10 m. b. S. Mg. O. Na. Si. 1.0. 2.0. 3.0. 4.0. 5.0. 6.0. 7.0. 8.0. keV. 9.0. Fig. S3. Fig. S4.

135 views • 4 slides

Fig. S1

Fig. S1. Fig. S2 a). Fig. S2 b).

174 views • 3 slides

Supplemental Fig. S1. Nishimura et al. PMB

Supplemental Fig. S1. Nishimura et al. PMB. A. RlemMT1. B. RlemMT2.

75 views • 1 slides

Fig. S1

Fig. S1. 0,4. 0,2. 0. -0,2. RIS. -0,4. Growth Rate. -0,6. -0,8. -1. -1,2. -1,4. -1,6. Strains. 0,4. 0,2. 0. -0,2. ALE. -0,4. Growth Rate. -0,6. -0,8. -1. -1,2. -1,4. Strains. 0,4. 0,2. 0. -0,2. IBA. -0,4. Growth Rate. -0,6. -0,8. -1. -1,2. -1,4. Strains.

109 views • 4 slides

[Fig. S1]

[Fig. S1]. S 1 2 3 4 5 6 7 8 9. S 1. KDa. KDa. 250. 200. 150. 116. 100. 97. 75. (A). (B). 66. 50. 45. 37. 25. 20.

86 views • 1 slides

Fig. S1

Fig. S1. A. B. **. Relative total length. Relative total length. **. *. *. control. 100ng/ml. 200ng/ml. 400ng/ml. HDFNs. HUVECs. HDFNs. HUVECs. CM. Transwell. TIMP-1. C. D. **. Relative total length. Relative total length. **. control. Con siRNA. TIMP-1 siRNA.

112 views • 3 slides

Fig. S1

A. B.

63 views • 1 slides

More Related