1 / 26

Folding-based Electrochemical Biosensors

Folding-based Electrochemical Biosensors. Rebecca Y. Lai Department of Chemistry University of Nebraska-Lincoln 1-16-09. Specific Binding. Specific Binding. Signal. Signal. Specific Binding. Biosensor. Biosensor. Biosensor. “Traditional” Biosensor. Measure changes in adsorbed mass,

fordon
Télécharger la présentation

Folding-based Electrochemical Biosensors

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Folding-based Electrochemical Biosensors Rebecca Y. Lai Department of Chemistry University of Nebraska-Lincoln 1-16-09

  2. Specific Binding Specific Binding Signal Signal Specific Binding Biosensor Biosensor Biosensor “Traditional” Biosensor Measure changes in adsorbed mass, polarizability, sterics or charge

  3. Specific Binding Specific Binding Signal Signal Biosensor Biosensor Signal Signal Signal Non Non - - specific Binding specific Binding Folding-based Biosensors: Signal Transduction Mechanism Signaling linked to a binding-specific change in the physical properties of the biopolymer

  4. Electrochemical Biosensors • Low background, fewer electrochemically active contaminants in biological systems • Low mass, volume, power • Low cost, mass production • Parallelization, adaptable to arraying strategies • Example: glucose meter

  5. Length: 1 mm Width: 0.88 mm Area : 0.88 mm2 Materials and Methods Biosensor Interrogation Method: Alternating Current Voltammetry Ref electrode Working electrode Counter electrode Microfabricated gold electrode array Gold disk electrodes 2 mm diameter Area : 3.14 mm 2

  6. Electrochemical DNA Sensor (E-DNA) + target sequence MB Denaturation / Re-annealing *Not to scale Gold Electrode 5’-HS-(CH2)6- GCAGTAACAAGAATAAAACGCCACTGC -(CH2)7-NH-3’-MB

  7. + 2e- Methylene blue Leucomethylene blue + H+ E-DNA Sensor AC Voltammograms • Reagentless (direct detection of aqueous DNA) • Sensitive (pM detection limit) • Rapid detection • Reusable • Selective • Specific

  8. E-DNA Sensor Reusable and Reproducible Selective

  9. E-DNA Sensor in a Microfluidic Chamber ***In-situ sensor fabrication, hybridization and regeneration Sensor Response Sensor Device

  10. Aptamers Aptamers are DNA or RNA molecules selected for their ability to fold into well-defined, three-dimensional structures and bind to specific molecular targets (e.g. proteins, small molecules) with high affinity.

  11. Efficient Electron Transfer Sluggish Electron Transfer + PDGF-BB MB Electrochemical Aptamer-Based (E-AB) Sensor:PDGF Detection • Reagentless • Reusable • Rapid • Specific • Selective • Parallelizable • Signal-on sensor *Not to scale 5’-HS-(CH2)6- CAGGCTACGGCACGTAGAGCATCA CCATGATCCTG-(CH2)7-NH-3’-MB

  12. Sensor Response to PDGF-BB In 50% Blood Serum Physiological concentration of PDGF in human serum = 400 pM (normal) – 700 pM (cancerous) Detection Limit: 50 pM (the mass ratio of PDGF-BB to serum protein is ~ 1 : 25 Million)

  13. Peptide or Protein-base Electrochemical Biosensors Ligand-induced Folding (LIF) Ligand-induced folding occurs when a favorable binding free energy overcomes an unfavorable folding free energy, producing a folded complex.

  14. Electronic Peptide-based Sensor (E-PB Sensor) MB et + target et MB - target * Not to scale • Peptide Probes • Naturally occurring peptide capable of LIF • Engineered peptide capable of LIF

  15. E-PB Sensor: HIV Detection Protein of Interest Surface Glycoprotein gp120 Transmembrane Glycoprotein gp41 Matrix Protein p17 Capsid Protein p24

  16. E-PB Sensor: HIV Detection Proteins of Interest Surface Glycoprotein gp120 Transmembrance Glycoprotein gp41 Matrix Protein p17 Capsid Protein p24

  17. Detection of Anti p24 Antibodies Probe Target Anti-p124 antibody (IgG) (~150 kDa) Response in earliest stages of AIDS Anti-p24 concentration in serum may be tens to hundreds of nanomolar HIV-1 p24 capsid protein Highly antigenic epitope sequence EAAWDRVHP

  18. Sensor Response to Anti-p24 Antibodies + Ab - Ab Probe Sequence: HS-C11-EAAWDRVHP-K-MB

  19. Future Direction of E-PB Sensor Research (Immediate!) Improve Sensor Specificity • Test sensor / self-assembled monolayer (SAM) using surface plasmon resonance (SPR) • Change / modify epitope if necessary Improve Sensor Sensitivity and Dynamic Range • New immobilization methods to increase surface coverage Improve Sensor Selectivity • New immobilization methods • Incorporate thiolated polyethylene-glycol (PEG)

  20. Future Direction of E-PB Sensor Research Click Chemistry Azide terminated alkanethiol + alkyne modified peptide w/ MB OH OH OH OH OH OH OH OH + Cu(I) + alkyne-peptide-MB N3 N3 • Advantages: • Flexibility in SAM choices • Step by step characterization by electrochemical methods and SPR • Site-specific modification/sensor fabrication * Not to scale

  21. Future Direction of E-PB Sensor Research • System of Interest: • HIV Detection (p24, p17, gp41, gp120) • Biosensor Array: Mixed-platform Detection • E-PB Sensor • E-AB Sensor • E-DNA Sensor • Hybrid E-PB Sensor

  22. Hybrid E-PB Sensor MB Peptide Loop et PNA Stem MB + Ab et - Ab * Not to scale Peptide nucleic acid (PNA) stem + Peptide loop p24 Probe Sequence: HS-C11-GAT-EAAWDRVHP-ATC-MB

  23. Handheld Potentiostat Future Directions in Device Fabrication Microfabricated Devices Too Pricy and Time Consuming! Disposable Sensor Strip gold-plated carbon electrode 2 mm diameter Area : 3.14 mm 2

  24. E-DNA Sensor on a Gold-plated Screen-printed Carbon Electrode Sensor Device Gold-plated Carbon Electrode 100%Serum Buffer Before Regenerated Hybridization 2 mm diameter Area : 3.14 mm 2

  25. Future Directions in Sensor Strip Fabrication • Disposable Sensor Strip: • Pros: cost effective, amenable to mass production • Cons: larger volume requirement • (50 µL in-situ, 10 µL ex-situ) • Future Work: • E-PB Sensor for HIV detection • Volume reduction • New electrode (array) design • Enhance sensor stability (6 months+ shelf life) Single use electrode (gold-plated carbon electrode ) 2 mm diameter Area : 3.14 mm 2

  26. Acknowledgement University of Nebraska-Lincoln Jennifer Gerasimov Dr. Weiwei Yang Socrates Canete Andy Springer UC Santa Barbara THANKS!

More Related