1 / 22

Characterization of the caprine PrP Gene:

Characterization of the caprine PrP Gene:. Study of new polymorphisms and relationship with the resistance/susceptibility to the scrapie disease. University of Zaragoza (Spain). http://www.tiho-hannover.de/einricht/zucht/eaap/descript/303.htm. Sheep scrapie susceptibility: Codon 136 (A V)

gerard
Télécharger la présentation

Characterization of the caprine PrP Gene:

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Characterization of the caprine PrP Gene: Study of new polymorphisms and relationship with the resistance/susceptibility to the scrapie disease University of Zaragoza (Spain) http://www.tiho-hannover.de/einricht/zucht/eaap/descript/303.htm

  2. Sheep scrapie susceptibility: Codon 136 (AV) Codon 154 (RH) Codon 171 (QR; QH) Goat scrapie susceptibility is linked to PrP gene polymorphisms? Introduction Hunter el al. (1994)

  3. 143H 154R I.P. 102G 142M I.P. Goldmann et al., 1996 and 1998; Billinis et al., 2002 Introduction Goat PrP gene polymorphisms

  4. Octapeptide region: 3 repetitions susceptibility 5 repetitions Introduction Goat PrP gene polymorphisms Goldmann et al., 1996 and 1998; Billinis et al., 2002

  5. Introduction Goat scrapie in Spain • Past: several scrapie animals belonging to mixed flocks (sheep + goats); • 2002: A scrapie goat in a herd composed of Alpine and Saanen goats.

  6. Objectives • Identify the scrapie affected goats in the herd. • Analyse the PrP sequence in the scrapie and healthy goats belonging to the herd. • Compare allele frequencies from the herd with healthy Alpine and Saanen populations. • Determine PrP polymorphism in native breeds.

  7. Animals • Natural scrapie infected herd: • Saanen (n=49), Alpine (n=48) and cross-breed (n=5)

  8. Animals • Natural scrapie infected herd: • Saanen (n=49), Alpine (n=48) and cross-breed (n=5) • Healthy control herds: • Saanen (n=42, 4 herds) • Alpine (n=39, 5 herds)

  9. Animals • Natural scrapie infected herd: • Saanen (n=49), Alpine (n=48) and cross-breed (n=5) • Healthy control herds: • Saanen (n=42, 4 herds) • Alpine (n=39, 5 herds) • Native goats: • Moncaina (n=41, 7 herds) • Pirenaica (n=21, 1 herd)

  10. 1 Alpine 1 Saanen Scrapie diagnosis • Clinical symptoms. • Western Blotting. • Immunohistochemistry.

  11. Goat PrP gene analysis • DNA extraction: • Blood • Brain tissue • Sequencing (Goldmann et al., 1996): • 20 fwd: • 5’ATGGTGAAAAGCCACATAGGCAGT3’ (20-42) • 767 rev: • 5’CTATCCTACTATGAGAAAAATGAG3’(789-767) • Statistical analysis: • 2 test (Yates correction)

  12. Alpine 211: CGA/CAA Arg/Gln PrP polymorphism in scrapie goats Saanen 142: ATA/ATG Ile/Met Silent Pol: 42: CCA/CCG (Pro) 138: AGT/AGC (Ser)

  13. PrP polymorphism in the scrapie herd Saanen 18:TGGCGG TrpArg 142: ATAATG IleMet 211: CGACAA ArgGln Silent Pol: 42: CCACCG (Pro) 138: AGTAGC (Ser) Alpine 18: TGGCGG 127: GGCAGC TrpArg GlySer 142: ATA/ATG 154: CGTCAT IleMet ArgHis 211: CGACAA 219: ACCATC ArgGln ThrIle 222: CAGCTGSilent Pol: GlnLeu 42: CCACCG 232: GGGCGG (Pro) GlyArg 138: AGTAGC (Ser) 211: TTCTTT (Phe) Crossbreed: No polymorphism

  14. PrP polymorphism in the scrapie herd

  15. 40 35 30 25 20 15 Alpine - 10 Alpine + 5 Saanen - * 0 ** RR Saanen + RQ QQ Significant differences between scrapie and healthy Saanen herds (* p < 0.05; ** p < 0.01). Comparison between scrapie and control herds Codon 211 Alpine positive goat: 211RGQ

  16. 45 40 35 30 25 20 15 Alpine - 10 Alpine + 5 Saanen - * 0 * II Saanen + IM MM Significant differences between scrapie and healthy Saanen herds (* p < 0.05). Comparison between scrapie and control herds Codon 142 Saanen positive goat: 142IM

  17. PrP polymorphism in native goat

  18. Summary / Conclusions

  19. 6 New goat PrP polymorphisms 18 W R 1 MVKSHIGSWI LVLFVAMWSD VGLCKKRPKP GGGWNTGGSR ..........................................................A...P............................................... 41 YPGQGSPGGN RYPPQGGGGW GQPHGGGWGQ PHGGGWGQPH .....................S............................................................................................... 81 GGGWGQPHGG GGWGQGGSHS QWNKPSKPKT NMKHVAGAAA .................................................................G.................................................. 121 AGAVVGGLGG YMLGSAMSRP LIHFGNDYED RYYRENMYRY ...........................................................MR............................H................ 161 PNQVYYRPVD QYSNQNNFVH DCVNITVKQH TVTTTTKGEN ..................Q............................................................................................. 201 FTETDIKIME RVVEQMCITQ YQRESQAYYQ RGASVILFSS ....................................................H.......................................................P 241 PPVILLISFL IFLIVG ....................................... 127 G S 142 I M 154 R H 219 T I 222 Q R 232 G R 211 R Q Silent mutations: 42: CCACCG 138: AGTAGC 201: TTCTTT

  20. PrP polymorphisms linked to scrapie susceptibility • Codon 211: • Alpine positive animal 211QR; • Significant differences between scrapie and control herds; • Homologous to human codon 208: • Human polymorphism RH associated with Creutzfeldt-Jakob disease in patients 129MM (homologous to goat codon 132 which is not polymorphic). • Codon 142: • Saanen positive animal 142MI.

  21. National Reference Centre for TSE: Cristina Acín Eva Monleón Juan J. Badiola Acknowledgements: Silvia Ruiz, Nuria Segovia, Carmen Cons EET2001-4033 Biochemical Genetics Laboratory: Clemen Rodellar Pilar Zaragoza DGA and MEC Aragón and Asturias Regional Governments Ramón y Cajal Program Research Group - Inma Martín-Burriel

  22. Thank you for your atention!

More Related