Useful hints and tips for cloning, PCR and site-directed mutagenesis

1. Useful hints and tips for cloning, PCR and site-directed mutagenesis Kirsten Jensen Division of Molecular Biosciences

2. Overview • Cloning (of PCR products) • Polymerase chain reaction (PCR) • Site-directed mutagenesis

3. MCS Cloning of a region of interest into a plasmid Plasmid Region of interest • Choose the right vector (+/- tag, and if tagged, a C- or N-terminal tag). • Blunt end or sticky end cloning. • Check that the enzymes chosen in the MCS for the cloning don’t cut in the region of interest. • Check that there is enough “space” in-between the two enzymes in the MCS. Sticky ends Blunt ends

4. Primers • Check the reading frame. • C-terminal tag: Add a Kozak consensus sequence (ANNATGG) if it is a C-terminal tag, and again remember to clone the gene in frame with the C-terminal tag. Don’t forget to take the STOP codon out. • Choose enzymes in the MCS to add to the primer that do not cut in the insert. • Primers should be 15-30 nucleotides long and have a GC content of 40-60 %. • The forward and reverse primer should have similar melting temperatures (Tm’s). • Try to avoid primer dimer and hairpin formation. • For sticky end ligation remember to add additional nucleotides to the 5’ side of the restriction site.The restriction site sequences should be followed by  15 bases that are homologous to the template DNA. • The 3’-end of the primer has to end on an C or a G.

5. Restriction enzymes (NEB) oligo % cleavage sequence 2h 20h BamHI CGGATCCG 10 25 CGGGATCCCG >90 >90 CGCGGATCCGCG >90 >90 EcoRI GGAATTCC >90 >90 CGGAATTCCG >90 >90 CCGGAATTCCGG >90 >90 HindIII CAAGCTTG 0 0 CCAAGCTTGG 0 0 CCCAAGCTTGGG 10 75 NcoI CCCATGGG 0 0 CATGCCATGGCATG 50 75 NdeI GGGTTTCATATGAAACCC 0 0 GGAATTCCATATGGAATTCC 75 >90

6. The principle of the PCR (Roche) • The purpose of the PCR is to make a huge number of • copies of a gene of interest • 3 steps in a PCR repeated for 30-40 cycles. • Denaturation at 95˚C: the double stranded DNA melts open to single stranded DNA. • Annealing/hybridisation: The primers anneal to the DNA. • Extension 68˚C or 72˚C: The polymerase copies the template adding the dNTPs • from 5’ to 3’.

7. 5’ 3’ 3’ 5’ PCR • 0.1-5 ng plasmid DNA and 0.1-1 ug for genomic DNA • 200 µM dNTPs (final concentration) • 1-1.5 U Taq polymerase and PfuTurbo polymerase 1.25-2.5U • 0.1-1 µM of each primer fwd/rev • 1-4 mM MgCl2 Taq polymerase (MgSO4 for Pfu polymerase) • DMSO up to 10% (has been shown to facilitate DNA separation) • Initial denaturation: 1 Cycle: 1 min. 95˚C is usually enough for plasmid DNA. For genomic DNA it will have to be longer. • 30-40 cycles PCR. • If using primers with restriction sites use a lower annealing temperature for the first 10 cycles of the PCR. • Final extension step: Incubate samples at 68˚C /72˚C for 5-15min to fill in the protruding ends of the PCR products. Taq DNA Polymerase adds extra A nucleotides to the 3'-ends of PCR products. If PCR fragments are cloned into T/A vectors, this step can be prolonged to up to 30min.

8. Cloning • Digest the vector and the amplified DNA for 2h or O.N. depending on the enzymes used. • Clean up the digested vector and fragment. • Check the concentration of the vector and the fragment on a gel. For Blunt end ligation (ratio vector : fragment; 1pmol : 10pmol) For sticky end ligation (ratio vector : fragment; 1pmol : 3pmol) • Negative control with vector only.

9. Problems after ligation Colonies on the negative control. • Poor cutting of the vector by the restriction enzymes. De-phosphorylation of the vector (also if using two different enzymes). • Colony screening using PCR. No colonies: • Poor cutting of the PCR product by the restriction enzyme because of inefficient extension by the polymerase. • Poor cutting due to insufficient number of extra nucleotides at the 5’ side of the restriction site. Clone the fragment blunt end and then cut it out. • Blunt end ligation: Use PfuTurbo polymerase.Taq DNA Polymerase adds extra A nucleotides to the 3'-ends of PCR products. Clone the PCR product into a A/T cloning vector or treat it with Klenow and dNTPs and then ligate.

10. Site-directed mutagenesis Workflow (Stratagene) Gene in plasmid with target site mutation Denature the plasmid and anneal the oligonucleotide primers containing the desired mutation Using the non-strand-displacing action of PfuTurbo polymerase, extend and incorporate the mutagenic primers resulting in nicked circular strands Digest the methylated, nonmutated parental DNA template with Dpn I Transform the circular, nicked dsDNA into super- competent cells After transformation the supercompetent cells repair the nicks in the mutated plasmid

11. * 3’ 5’ 5’ 3’ * Primer design for site-directed mutagenesis Stratagene: • Both primers must contain the mutation. • The mutation should be in the middle of the primer. • Primers should be 25-45 nucleotides long and have a GC content of at least 40%. • The melting temperature (Tm) should be ≥ 78˚C. • The 3’-end of the primer has to end on an C or a G.

12. 5’ 3’ * 3’ 5’ 5’ * 3’ 3’ 5’ * Primer design for site-directed mutagenesis Invitrogen: • Only one primer contains the mutation. • Both primers should be ~ 30 nucleotides long. • Primers should have an overlapping region at the 5’ end of 15-20 nucleotides. • On the mutagenic primer, there should be at least 10 nucleotides downstream of the mutation. Literature:(Zheng et al. An efficient one-step site-directed and site-saturation mutagenesis protocol. Nucleic Acids Res. 2004 Aug 10;32(14):e115). • Both primers must contain the mutation. • At least 8 non-overlapping bases at the 3’ end. • The 3’-end of the primer has to end on an C or a G.

13. Site-directed mutagenesis • 5-50 ng/50 µl reactions of dsDNA plasmid DNA from a dam+ E.coli strain • 125-250ng/50 µl reactions of forward and reverse primer (PAGE or HPLC purified) • 200 µM dNTPs • 2 mM MgSO4 • 2.5 U of PfuTurbo polymerase • DMSO up to 10% (has been shown to facilitate DNA separation) Problems: • No product: Don’t continue. • When using DMSO add more PfuTurbo polymerase. • If the oligo anneals several times, extend the oligo and increase the annealing temperature. • Primer dimer and hairpin: Use asymmetric oligos. • Repeats on either site of the mutation: Try shorter oligos and increase the annealing temperature

14. Papers and useful websites PCR • Barnes WM. PCR amplification of up to 35-kb DNA with high fidelity and high yield from lambda bacteriophage templates. Proc Natl Acad Sci U S A. 1994 Mar 15;91(6):2216-20. • http://www.fermentas.com/ Site-directed mutagenesis • http://www.stratagene.com/ • http://www.invitrogen.com/ • Zheng et al. An efficient one-step site-directed and site-saturation mutagenesis protocol. Nucleic Acids Res. 2004 Aug 10;32(14):e115.