The Genetics of Asthma

1. The Genetics of Asthma Jenifer Parsons

2. Outline • Heredity of Asthma • Chromosome 7p2 • Locating the Region • Finding a Gene • Conclusions of Authors • Why Does It Matter?

3. Heredity of Asthma • Interest in finding a genetic susceptibility locus is based on the heritability that asthma shows. • Children with one asthmatic parent 3-6 times more likely to develop asthma than a child with two normal parents1. • Children with two asthmatic parents 10 times more likely to develop asthma than normal1.

4. Chromosome 7p2 • Previously completed genome-wide scan for asthma implicated six tentative genetic loci. • One of those was Chromosome 7p. • Scientists selected 7p for candidate gene study.

5. Locating the Region • Process: Began by genotyping the region of Chromosome 7p that they were interested in and analyzing results. If a haplotype occurred more often in patients than controls, density of markers was increased to guide further genotyping. • Method of Analysis: Haplotype Pattern Mining (HPM) Algorithm. • Searched for haplotypes associated with high serum IgE • Suggested strong association of conserved haplotype pattern between NM51 and SNP563704 (47 kb region).

6. Locating the Region • Next tried to determine limits of critical region. • Did additional genotyping and analysis to reveal a strong association of a conserved region of 133-kb.

7. Locating the Region • Then compared patient homozygous for susceptibility and control subject homozygous for most nonrisk haplotype with the public sequence. • Control subject only differed from public sequence by two SNPs. • Patient showed 72 previously unknown SNPs and 8 deletion/insertion polymorphisms.

8. Locating the Region • There was strong linkage disequilibrium shown between the markers in the 133-kb region. • Means that the observed haplotype frequencies differed from predicted haplotype frequencies.

9. Locating the Region • Genotyped two additional populations and found that most of the SNPs were shared. • Figure shows linkage disequilibrium in French Canadian population.

10. Locating the Region • Phylogenetic analysis confirmed that risk haplotypes were closely related and distinct from the nonrisk haplotypes. • H1, H3, and H6 are considered nonrisk haplotypes. • H2, H4, H5, and H7 are considered the most common risk haplotypes in the populations tested.

11. Locating the Region • The next step was to determine whether the heredity displayed by asthma could be explained by these conserved haplotypes. • To resolve this, the researchers looked at parent-offspring transmission and sibling-pair sharing of high IgE. • One of the risk haplotypes cosegregated in 26 of 51 transmissions (51%) and was shared in 26 of 40 siblings (65%).

12. Finding a Gene • Now that the scientists had located a susceptibility locus, they began scanning the region for genes. • Two were found. One was discounted after none of its possible isoforms showed homology to any previously identified proteins. • The other had two isoforms (A and B). It was named GPRA (gene protein receptor for asthma susceptibility).

13. Finding a Gene • Isoform A is expressed mainly in smooth muscle; isoform B is expressed mostly in epithelial cells. • In comparisons of bronchial biopsies of both asthmatics and control samples, no distinct differences in expression were scene for isoform A. • However, there were visible differences in isoform B expression.

14. Finding a Gene

15. Finding a Gene • As a final test, lung inflammation was induced in mice to monitor the response of GPRA ortholog mRNA production. • As shown in the chart, it increased significantly.

16. Conclusions of Authors • The results of these experiments strongly implicate GPRA in asthmatic response. • However, there have also been other genes implicated in asthma susceptibility. • The biochemical mechanisms linking any of these genes to asthmatic processes are not understood very well.

17. Conclusions of Authors • For example, GPRA may be part of some unknown pathway that is critically altered in asthma. • GPRA is also expressed in gut epithelia and keratinocytes in the skin. It could play a role in a number of other allergic diseases (e.g. lupus, food allergies).

18. Why Does It Matter? • Further study of GPRA and/or other genes that have been related to asthma could help us to better understand the disease. • Finding some way to alter the structure and/or function of GPRA could lead to new more effective asthma treatments.

19. Questions? gggctcaggg agggctctgt gcctccgttc agcagagctg cagctgctgc ccagctctcaggaggcaagc tggactccct cactcagctg caggagcaag gacagtgagg ctcaaccccg cctgagccat gccagccaac ttcacagagg gcagcttcga ttccagtggg accgggcaga cgctggattc ttccccagtg gcttgcactg aaacagtgac ttttactgaa gtggtggaag gaaaggaatg gggttccttc tactactcct ttaagactga gcaattgata actctgtggg tcctctttgt ttttaccatt gttggaaact ccgttgtgct tttttccaca tggaggagaa agaagaagtc aagaatgacc ttctttgtga ctcagctggc catcacagat tctttcacag gactggtcaa catcttgaca gatattaatt ggcgattcac tggagacttc acggcacctg acctggtttg ccgagtggtc cgctatttgc aggttgtgct gctctacgcc tctacctacg tcctggtgtc cctcagcata gacagatacc atgccatcgt ctaccccatg aagttccttc aaggagaaaa gcaagccagg gtcctcattg tgatcgcctg gagcctgtct tttctgttct ccattcccac cctgatcata tttgggaaga ggacactgtc caacggtgaa gtgcagtgct gggccctgtg gcctgacgac tcctactgga ccccatacat gaccatcgtg gccttcctgg tgtacttcat ccctctgaca atcatcagca tcatgtatgg cattgtgatc cgaactattt ggattaaaag caaaacctac gaaacagtga tttccaactg ctcagatggg aaactgtgca gcagctataa ccgaggactc atctcaaagg caaaaatcaa ggctatcaag tatagcatca tcatcattct tgccttcatc tgctgttgga gtccatactt cctgtttgac attttggaca atttcaacct ccttccagac acccaggagc gtttctatgc ctctgtgatc attcagaacc tgccagcatt gaatagtgcc atcaaccccc tcatctactg tgtcttcagc agctccatct ctttcccctg cagggtcatc cgtctccgtc agctccagga ggctgcgcta atgctctgcc ctcaacgaga gaactggaag ggtacttggc caggtgtacc ttcctgggct cttccaaggt gacagctctc accctgtgct gcaggtggcc ctgtgcctgg tgccacttct cactgcttac cagggcacaa ggacaccagt ggttcccaaa atgggtcaca gcaggatggc ctgcatcaga ttcaccaggg agggctataa gaaggcagac

20. Bibliography 1MedicineNet.com. http://www.medterms.com/ script/main/art.asp?articlekey=2373. April 8, 2004. November 28, 2004 2Laitinen, Tarja, Anne Polvi, Pia Rydman, Johanna Vendelin, Ville Pulkkinen, Paula Salmikangas, Sira Makela, Marko Rehn, Asta Pirskanen, Anna Rautanen, Marco Zuccheli, Harriet Gullsten, Marina Leino, Harri Alenius, Tuula Petays, Tari Haahtela, Annika Laitinen, Catherine Laprise, Thomas J. Hudson, Lauri A. Laitinen, Juha Kere. Characterization of a Common Susceptibility Locus for Asthma-Related Traits. Science Vol 304. April 4, 2003. March 9, 2004.