Understanding how environmental adversity increases suicide risk: epigenetic mechanisms

1. Understanding how environmental adversity increases suicide risk: epigenetic mechanisms Gustavo Turecki MD PhD William Dawson Chair Douglas Hospital Research Centre McGill University

2. CSA, CPA and Suicide Attempts Fergusson et al. Child Abuse & Neglect, 2008

3. Childhood abuse and SB Brezo et al, British J Psychiatry 2008

4. Suicide and Childhood AdversitySuicide completers %

5. How can events occurring during childhood influence suicide risk later on in life?

6. HPA Axis

7. Glucocorticoid Receptor (GR) regulation, quality of maternal care, and cognitive function in rats Regulation of hippocampal GR expression by maternal care…. … affects behavioral phenotype in adult rats. Francis et al., Science 1999; Caldji et al., PNAS 1998

8. Nerve growth factor-inducible protein A (NGFI-A) Meaney and Szyf, 2005

10. ACCCCTTAGGCCTAGGGAACTTCTTACCTACCTTGGCGCGCGCGCGCGCGCGCTTACCTTTTTAATATAACCCCTTAGGCCTAGGGAACTTCTTACCTACCTTGGCGCGCGCGCGCGCGCGCTTACCTTTTTAATATA CCTTGAAGAATGGATGGAACCGCGC

11. Regulation of Gene Expression

12. Serotonin transporter gene (5HTT) and sequence variability 5-HTT gene Promoter variants AAAGGRRRRGTTAGTAC – short (s) variant AAAGGRRRRRRRRRRRRRRRRRRRRGTTAGTAC – long (L) variant S variant L variant

13. Epigenetics: DNA Methylation Protein CH3 CH3 CH3 Protein Protein Environmental factors

14. Epigenetics:Chromatin modifications Active Inactive Tsankova et al, 2007

16. Same DNA, different phenotypes

17. MZ twins raised appart

18. Volcano plots of four MZ twin versus co-twin WBC DNA methylation profile comparisons (black), with overlay of four matched twin DNA versus self comparisons (green) for each set of MZ twins Kaminsky et al, Nat Genet 2009

19. GR gene: 11 untranslated exon 1variants in Rats and Humans Turner and Muller, Mol. Endo. 2005

20. GR methylation, GR expression and cognitive function in rats Weaver et al., Nat:Neurosci 2004 Nerve growth factor-inducible protein A (NGFI-A)

21. Weaver et al., Nat Neurosc 2004

22. HPA Axis

23. GR regulation, early life trauma, and cognitive function in humans • Hippocampal GR in humans: • GR mRNA is downregulated in different psychiatric illnesses. Webster et al., Mol. Psych. 2002

24. Trier Social Stress Test and Suicide Risk McGirr et al, 2008

25. Could early childhood adversity be associated with increased GR promoter methylation in suicide?

26. Structure of exon 1F in Humans

27. Sample Suicides with documented evidence of severe childhood abuse/neglect (N=12) AOD =34.17 years PMI = 24.20 pH = 6.32 Suicides with out Hx of abuse/neglect (N=12) AOD = 33.8 PMI =39 pH=6.5 Sudden death controls without Hx of abuse/neglect ( N= 12) AOD = 35.75 years PMI = 23.45 pH = 6.44

28. GR expression in human hippocampus McGowan et al, Nature Neurosci 2009

30. Is the increased GR promoter methylation a general genomic effect?

31. Nearest Neighbour analysis of methylated CpG content McGowan et al, PlosOne 2008

32. In vitro analysis of GR1F promoter methylation 255 bp (solid underline) construct 125 bp ( broken underline) construct Circles: specific CpGdinucleotidesmethylated in each construct Boxes represent known or putative canonical and noncanonical NGFI-A binding sites with the shaded area: beginning of the exon McGowan et al, Nat Neuroscience 2009

33. Patch Methylation and ChIPAssays McGowan et al, Nat Neuroscience 2009

34. GR studiesConclusion

35. Early negative life stressors Mediators Moderators Biological and Genetic Examples: Suicide Makeup Example: Personality traits: high IIABs Gender Substance abuse Life events Major Depression Genetic makeup Social factors Turecki, JPN 2005

37. gustavo.turecki@mcgill.ca • www.douglasrecherche.qc.ca/suicide