330 likes | 418 Vues
Biotechnology. DNA Technology. What is Biotech. Biobyte – what is biotech. Restriction enzymes. Bacteria fight invading viruses with Restriction Enzymes. Degrade phage DNA by cleaving (cutting) it into fragments. .
E N D
Biotechnology DNA Technology
What is Biotech Biobyte – what is biotech
Restriction enzymes Bacteria fight invading viruses with Restriction Enzymes. Degrade phage DNA by cleaving (cutting) it into fragments.
Why doesn’t a restriction enzyme cut the DNA of the bacterial cell that makes it? Methylation protects the bacteria’s own DNA from being cleaved.
Example For example, the enzyme EcoRI cuts DNA only where it encounters the following paired sequence in the DNA double helix:
You try it! TCGAATTCTAGGCTAACCGGAGASTTCACCGTACGAATTCCTTCAGCAATTCAGACGTA (video clip – human physiology restriction enzymes)
Gel Electrophoresis When DNA is treated with restriction enzymes, the DNA is cut into fragments of various sizes. These fragments can be separated in a gel on the bases on their electric charge and size.
Gel Electrophoresis Flash video
DNA fingerprinting • DNA-based technique for identifying individuals. • Uses restriction analysis and electrophoresis.
DNA Fingerprinting DNA fingerprinting methods require at least 1 µg of DNA, or the DNA content of about 100,000 human cells.
polymerase chain reaction (PCR) Can multiply (“amplify”) the DNA of interest from even a single cell, producing in a few hours the necessary 1 µg for restriction digestion and electrophoresis.
PCR 1) Double-stranded fragments of DNA are separated into single strands by heating (denatured).
PCR 2) ADD: a) A short primer b) along with the Bases (A,C,T,G) c) DNA polymerase to catalyze the production of complementary new strands. (video polymerase chain reaction animated)
DNA BARCODE Identify each species with a “DNA barcode” He chose is the cytochromeoxidase gene. Mutates readily, there should be many differences between species. Present in most cells Reasonable in size (650-750 base pairs)
Why DNA barcode? advance biological research on evolution to track species diversity help identify new species detect undesirable microbes or bioterrorism agents