Transcription in Eukaryotes

1. Transcription in Eukaryotes Transcription RNA Processing Psssst…DNA can’tleave nucleus! Translation Protein

2. Transcription in Eukaryotes • 3 RNA polymerase enzymes • RNA polymerase 1 • only transcribes rRNA genes • makes ribosomes • RNA polymerase 2 • transcribes genes into mRNA • RNA polymerase 3 • only transcribes tRNA genes • each has a specific promoter sequence it recognizes

3. Transcription in Eukaryotes • Initiation complex • transcription factors bind to promoter region upstream of gene • suite of proteins which bind to DNA • turn on or off transcription • TATA box binding site • recognition site for transcription factors • transcription factors trigger the binding of RNA polymerase to DNA

4. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Post-transcriptional processing • Primary transcript (pre-mRNA) • eukaryotic mRNA needs work after transcription • mRNA processing (making mature mRNA) • mRNA splicing = edit out introns • protect mRNA from enzymes in cytoplasm • add 5 cap • add polyA tail 3' poly-A tail 3' A A A A A mRNA 50-250 A’s 5' cap P P P 5' G ~10,000 bases eukaryotic DNA pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

5. snRNPs snRNA intron exon exon 5' 3' spliceosome 5' 3' lariat 5' 3' exon exon mature mRNA excised intron 5' 3' Whoa! I think we just brokea biological “rule”! Splicing enzymes • snRNPs • small nuclear RNA • proteins • Spliceosome • several snRNPs • recognize splice site sequence • cut & paste No, not smurfs! “snurps”

6. 1982 | 1989 Ribozyme • RNA as ribozyme • some mRNA can even splice itself • RNA as enzyme Sidney Altman Thomas Cech Yale U of Colorado

7. Translation fromnucleic acid languagetoamino acid language

8. Bacterial chromosome Translation in Prokaryotes Transcription mRNA Translation Psssst…no nucleus! protein Cell membrane Cell wall

9. Translation in Prokaryotes • Transcription & translation are simultaneous in bacteria • DNA is in cytoplasm • no mRNA editing • ribosomesread mRNA as it is being transcribed

10. Translation: prokaryotes vs. eukaryotes • Differences between prokaryotes & eukaryotes • time & physical separation between processes • takes eukaryote ~1 hour from DNA to protein • RNA processing

11. Translation in Eukaryotes

12. aa aa ribosome aa aa aa aa aa aa From gene to protein transcription translation DNA mRNA protein mRNA leaves nucleus through nuclear pores proteins synthesized by ribosomes using instructions on mRNA nucleus cytoplasm

13. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? How does mRNA code for proteins? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 4 ATCG 4 AUCG 20

14. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA codon MetArgValAsnAlaCysAla protein ? mRNA codes for proteins in triplets

15. The code • Code for ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid • 3rd base “wobble” Why is thewobble good? • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

16. GCA UAC CAU Met Arg Val How are the codons matched to amino acids? 3 5 TACGCACATTTACGTACGCGG DNA 5 3 AUGCGUGUAAAUGCAUGCGCC mRNA codon 3 5 tRNA aminoacid anti-codon

17. aa aa ribosome aa aa aa aa aa aa From gene to protein transcription translation DNA mRNA protein nucleus cytoplasm

18. Transfer RNA structure • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on 3 end

19. Ribosomes • Facilitate coupling of tRNA anticodon to mRNA codon • organelle or enzyme? • Structure • ribosomal RNA (rRNA) & proteins • 2 subunits • large • small E P A

20. Ribosomes • A site (aminoacyl-tRNA site) • holds tRNA carrying next amino acid to be added to chain • P site (peptidyl-tRNA site) • holds tRNA carrying growing polypeptide chain • E site (exit site) • empty tRNA leaves ribosome from exit site Met C A U 5' G U A 3' E P A

21. 3 2 1 Building a polypeptide • Initiation • brings together mRNA, ribosome subunits, initiator tRNA • Elongation • adding amino acids based on codon sequence • Termination • end codon release factor Leu Val Ser Met Met Ala Leu Met Met Leu Leu Trp tRNA C A G C G A C C C A A G A G C U A C C A U A U U A U G A A 5' 5' A A 5' C U U 5' A A G G A G U U G U C U U U G C A C U 3' G G U A A U A A C C mRNA 3' 3' 3' U G G U A A 3' E P A

22. Destinations: • secretion • nucleus • mitochondria • chloroplasts • cell membrane • cytoplasm • etc… Protein targeting • Signal peptide • address label start of a secretory pathway

23. RNA polymerase DNA Can you tell the story? aminoacids exon intron tRNA pre-mRNA 5' cap mature mRNA aminoacyl tRNAsynthetase polyA tail 3' large ribosomal subunit polypeptide 5' tRNA small ribosomal subunit E P A ribosome

24. Can you tell the story?

25. Translation • Codons • blocks of 3 nucleotides decoded into the sequence of amino acids

26. Wrap up • The flow of genetic information from DNA to protein in eukaryotic cells is called the central dogma of biology. (a) Explain the role of each of the following in protein synthesis in eukaryotic cells. • The central dogma does not apply to some viruses. Select a specific virus or type and explain how it deviates from the central dogma. • Cells regulate both protein synthesis and protein activity. Discuss TWO specific mechanisms of protein regulation in eukaryotic cells

27. Anwers