1 / 18

Talk overview

Speaker: Jakob Fredslund, computer scientist, post doc. at Bioinformatics Research Centre, Aarhus University. Talk overview. Overall project scenario PriFi – finding primers based on a multiple alignment Web version PriFi demo Project results Project pipeline demo. Overall project aim.

jwozniak
Télécharger la présentation

Talk overview

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Speaker: Jakob Fredslund, computer scientist, post doc. at Bioinformatics Research Centre, Aarhus University.

  2. Talk overview • Overall project scenario • PriFi – finding primers based on a multiple alignment • Web version • PriFi demo • Project results • Project pipeline demo

  3. Overall project aim Development of • General molecular markers for legume genetics • unique, variable, known sequence • markers may be associated with important breeding traits • many markers  greater chance of trait association • general: each marker should be shared by all legumes • PCR primers for the markers • One set per marker, should work for all legumes

  4. Identification of evolutionarily conserved regions Alignment of ESTs from multiple legume species Align to genomic region Intron • Design PCR primers in conserved regions • - Hopefully primers work in related species too • Amplification of intron • - Weak selection pressure on introns  good chance of • finding polymorphism CATS – comparative anchor tagged sequences

  5. Legumes • We don't have a complete legume genome • If incomplete genome is used: • Markers may have undiscovered paralogs in genome and hence also in other legumes • Won't know which sequence we're actually reading with PCR • Use complete Arabidopsis thaliana genome instead Genomic regions that haven't been sequenced ? ACGCATCGATTCGCGAACTG

  6. Arabidopsis and legumes Legumes • If Arabidopsis has 2 copies of some gene, its legume ortholog probably exists in only 1 copy • EST has 1 or 2 hits in Arabidopsis  probably unique in legumes  useful as marker candidate Arabidopsis whole genome duplication

  7. Large-scale: Legume pipeline

  8. Primer design Usual method: Visual inspection of alignment  "manual" design of primers. Primer consensus sequences: Fw: TGCYTCAAAGGAGGAAATTTCAARAG Rv: CTGTCAAYACCAGTATTTGCCCKKG introns replaced by X'es to help Clustal Good marker region Idea: automate primer design through computer program.

  9. Primer finder program PriFi Works with alignment (or Fasta file which it aligns itself using Clustal). • Identifies conserved regions and locates introns • Identifies individual primer candidates • Checks most criteria • Considers pairs of primer candidates • Checks remaining criteria • Ranks all pairs • Suggests four pairs and explains their scores • Lets user make informed choice (discussions showed primer design is not exact science!).

  10. Fw 5'-ATCCGATTTCGAGAAATGCAAACCCTGGTTGATCC Rv 5'-CCCTTCACAGTGGTGATACACTTTCGCTTGTTACG Tm = 66.4 / 66.9 Primer lengths: 35 / 35 Avg. #sequences in primer alignments: 3.0 / 2.0 Estimated product length: 1785 Primer/intron distances: 36 / 88 A/T's among last 8 bp of 3'-end: 4 / 5 Ambiguities: 0 / 0 93.2: High-Tm bonus 6.0: Fw primer length 6.0: Rv primer length 24.7: bonus for #sequences in primer alignments 3.0: Fw has G/C terminal in 3'-end 3.0: Rv has G/C terminal in 3'-end 60.0: Good product length -5.0: Rv in unconserved region or based mostly on 2 seqs -11.3: Primer/intron distance(s) outside 70-150 bp -3.0: Too high AT content in 3'-ends Score: 176 Report

  11. PriFi on the web Can't do batch runs, otherwise same program

  12. Configuration Critical melting temperature If both primer melting temperatures are below this value, penalize the pair. Somewhat heuristic parameters and rules..  Optimal PCR product length interval Penalty Ok Optimal Ok Penalty points p2 p3 PCR prod len p1 p4 Introns in sequences If set to 'no', primer pairs do not have to span an intron (and introns are not marked by X'es).

  13. PriFi demo

  14. PriFi user statistics 2109 true hits in total. Users from 37 countries.

  15. Project results in interactive web table

  16. Web-based pipeline

  17. Thanks for your attention. Email: jakobf@birc.au.dk http://cgi-daimi.au.dk/cgi-chili/PriFi/main http://cgi-daimi.au.dk/cgi-chili/GeneticMarkers/table http://cgi-daimi.au.dk/cgi-chili/GeMprospector/main People involved in developing PriFi: Leif Schauser (BiRC), Lene H. Madsen, Niels Sandal (Dept. of Mol. Biology). Grant holder: Jens Stougaard.

More Related