1 / 34

Introduction Basic Genetic Mechanisms Eukaryotic Gene Regulation The Human Genome Project Test 1

Molecular Genetics. The Human Genome: Biology and Medicine. Introduction Basic Genetic Mechanisms Eukaryotic Gene Regulation The Human Genome Project Test 1 Genome I - Genes Genome II – Repetitive DNA Genome III - Variation Test 2 Monogenic and Complex Diseases Finding ‘Disease’ Genes

lavada
Télécharger la présentation

Introduction Basic Genetic Mechanisms Eukaryotic Gene Regulation The Human Genome Project Test 1

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Molecular Genetics The Human Genome: Biology and Medicine • Introduction • Basic Genetic Mechanisms • Eukaryotic Gene Regulation • The Human Genome Project • Test 1 • Genome I - Genes • Genome II – Repetitive DNA • Genome III - Variation • Test 2 • Monogenic and Complex Diseases • Finding ‘Disease’ Genes • Pharmacogenomics • Test 3 • Your Presentations • Your Presentations • Happy New Year!  http://priede.bf.lu.lv/ Studiju materiāli / MolekularasBioloģijas / MolGen / EN

  2. The Human Genome 21 000

  3. Polymorphisms (common variation): majority – neutral • The rest: • slightly “bad” (predispose to disease) • slightly “good” (protect from disease) • both slightly bad and good (predispose to and protect from certain conditions) Polymorphisms Minor allele frequency > 1% GENETIC VARIATIONS: alternatives of genomic DNA sequence (alleles) that are present in individual (-s) or population (-s) Minor allele frequency < 1% MUTATIONS Rare variants “Bad”: cause genetic disease

  4. Types of genetic variations CCTAGTTGACTGATCGCGGGATTCACACACATGG CCTGGTTGAC..ATCGCGGGATTCACACACACACATGG • SSR – short sequence repeats • (VNTR - variable number tandem repeats) • many alleles • microsatellites (1-5) • minisatellites (6-100) • … • > 1,000,000 • InDels • (insertions/deletions) • two alleles • > 1,000,000 • Single (point) base changes • two alleles • SNPs • Single Nucleotide Polymorphisms; > 10, 000, 000 • Inversions • Duplications • Translocations • Transposon insertions • Variations exceeding 1000bp - STRUCTURAL VARIATIONS • less than 3 million bp - submicroscopic; larger– microscopic • InDels and duplications are called CNVs (copy number variations)

  5. Molecular Biology of the Cell,4th Edition Each person is unique

  6. At the same time, humans “are essentially identical twins” 6 000 000 000 < 3000 generations RAO(R) – Recent African Origin (and Replacement) 10 000

  7. Genetic diversity is highest in Africans Populationcodes: AF, African-American; AS, Asian; CA,Caucasian; and HL, Hispanic-Latino.

  8. Genetic diversity is highest in Africans

  9. Use of common variations in genetic association studies CD /CV (Common Disease/Common Variants) hypothesis: Common diseases areunderliedby a few common variants CD/RV(Common Disease /Rare Variants) – diseases are driven by manyrare alleles

  10. Genes SNPs SNP map • A map of human genome sequence variation... • The International SNP Map Working Group. Nature (2001) 409, 928-933. • Features of the map: • 1.42 million SNPs • average density 1 SNP every 1.9 kilobases • 60 000 SNPs fall within exons • 85% of exons are within 5 kb of the nearest SNP

  11. Good properties Many 90% Simple binary Even relatively Stable evolutionary MARKERS Properties of SNPs from a distinct point of view Bad property - some SNPs(alleles) increase the risk of disease • Other SNP properties • ~ 0.1% affect protein function • the same number might affect gene expression • Distribution is non-uniform • genome-wide (0.1% - 10%) • between chromosomes (autosomes > X > Y) • more in non-coding than coding regions • in coding sequences silent substitutions> missense • 2/3 are transitions (metC deamination in CpGs) • Cosmopolitan / Population-specific

  12. Analysis of some SNPs can capture effects of other SNPs MARKERS This is possible owing to Linkage Disequilibrium (LD)

  13. G C C G C A G T C G T A Gene SNPs A C C A C A G T A A C C A T C G C C A T A A T A LD There is a limited diversity of haplotypes if LD is present There are many haplotypes in the absence of LD • LD - Linkage Disequilibrium – non-random association among alleles at two or more loci in POPULATION (or a measure of co-segregation of alleles in population) • Haplotype – combination of alleles on a chromosome (usually used with respect to a small region)

  14. There is a limited diversity of haplotypes when LD exists

  15. PA and PB - allele frequencies PAB - haplotype frequencies D = PAB - PA x PB D’= D/DMax 50 % G C 50 % A T 0 % A C 0 % G T 40 % 25 % G G C C 40 % 25 % A A T T 25 % 10 % A A C C 25 % 10 % G G T T The strength of LD varies and can change All SNP alleles in this example have frequency = 50 % A a B b G C A T D = 0.25 D’= 1 Complete LD D = 0.15 D’= 0.6 Partial LD D = 0 D’= 0 No LD

  16. GENETIC mutagenesis recombination gene conversion DEMOGRAPHIC population age genetic drift population dinamics migration bottlenecks … Processes shaping genetic variation and LD NATURAL SELECTION

  17. (i) Genetic processes: recombination

  18. LD, recombination, and age of population Recombinant DNA, 3rd Edition

  19. Example of origin and decay of LD N Engl J Med 2002;347:1512-1520. Genomic Medicine — A Primer.

  20. (ii) Demographic processes: genetic drift and “founder” mutations Recombinant DNA, 3rd Edition

  21. Raven & Johnson (2004) Biology. Fig. 21.6 (ii) Demographic processes:“bottleneck” effect

  22. (iii) Natural Selection: hitchhiking

  23. LD islands or recombination deserts Recombination rates vary by more than an order of magnitude across the genome

  24. Human genome is made up of haplotype blocks

  25. Human genome is made up of haplotype blocks Haplotype map (HapMap) project – finished in 2005

  26. The practical aim of the HapMap project ‘tag’ SNP MARKERS If haplotypes are known, all common variation of a region can be determined through genotyping just a few tag SNPs

  27. SNP genotyping principles Nature Reviews Genetics (2001) 2, 930 -942. Genotype – the genetic constitution of an individual Genotyping – the process of allele detection

  28. Structural variations (microscopic) in the human genome INVERSION TRANSLOCATION NATURE REVIEWS | GENETICS VOLUME 7 | FEBRUARY 2006 | 87

  29. Structural variations (submicroscopic) in the human genome CNV

  30. Copy-number variations (CNV) NATURE REVIEWS | GENETICS VOLUME 7 | FEBRUARY 2006 | 87

  31. Possible influence of structural variants Human Molecular Genetics, 2006, Vol. 15, Review Issue 1 R59

  32. CNV map ~1500 CNVs 360Mb 12% of genome NATURE| Vol 444|23 November 2006; pp 444-454

  33. http://www.nature.com/nature/focus/1000genomes/

  34. Molecular Genetics The Human Genome: Biology and Medicine • Introduction • Basic Genetic Mechanisms • Eukaryotic Gene Regulation • The Human Genome Project • Test 1 • Genome I - Genes • Genome II – Repetitive DNA • Genome III - Variation • Test 2 • Monogenic and Complex Diseases • Finding ‘Disease’ Genes • Pharmacogenomics • Test 3 • Your Presentations • Your Presentations • Happy New Year!  http://priede.bf.lu.lv/ Studiju materiāli / MolekularasBioloģijas / MolGen / EN

More Related