150 likes | 299 Vues
Protein Synthesis. Beth Walker. Importance of Proteins & DNA. DNA carries the instructions for making all proteins. A portion of a DNA strand with instructions for making a protein is called a gene Proteins are made up of many building blocks or monomers called amino acids.
E N D
Protein Synthesis Beth Walker
Importance of Proteins & DNA • DNA carries the instructions for making all proteins. • A portion of a DNA strand with instructions for making a protein is called a gene • Proteins are made up of many building blocks or monomers called amino acids.
Importance of Proteins & DNA • Proteins perform the following important functions: • Enzymes, which speed up chemical reaction sin the body. • Keratin, which makes up our hair and nails. • Collagen, which makes up our skin. • Hemoglobin, which transports O2 in our body E. There are 20 different amino acids, such as valine, lysine, and leucine, which are put in various arrangements to make proteins
How Does Transcription Occur? • Starts with replication • Location: nucleus and cytoplasm • DNA is once again split apart by an enzyme • Free-floating mRNA nucleotides attach to the exposed DNA strand. REMEMBER THERE IS NO THYMINE IN mRNA!!!!!
How Does Transcription Occur? • mRNA separates from DNA and we now have a single-strand of messenger RNA. 6. Three nucleotides on an mRNA strand are called a codon. By looking at a codon chart, we can determine the amino acid that mRNA strand will put together.
Using the Chart • PRACTICE USING THE CODON CHART……look up the amino acid for each codon listed below. UUG leucine UAC tyrosine ACG theorine AAA lysine
Using the Codon Chart • ***Notice that there are start and stop codons that will tell where to begin and where to end the protein. • The start codon is AUG, so the first amino acid in a protein will always be methionine 8. The stop codons are UAA, UGA, and UAG. The last amino acid in a protein will always be coded by a “stop” codon.
How does Translation Occur? • The amino acids coded for by the codons are linked together to make a protein. • Location: ribosome • mRNA travels out of the nucleus to a ribosome. 4. The ribosome looks for the “start” codon.
How Does Translation Occur? • All codons after that will attach to the ribosome. 6. In the cytoplasm, tRNA, a clover-leaf shaped RNA, will attach to free floating amino acids and form anticodons (made up of tRNA). 7. Amino acids come from proteins that we eat and they are broken down during digestion. 8. tRNA pairs with mRNA and brings the correct amino acid with it to the ribosome. • Peptide bonds are formed between the amino acids, and voila, a protein is formed. Transcribe & Translate a Gene Here
Transcription & Translation – Practice Problem DNA: GCGTATTACGGGGTGCCATATACTGGT mRNA: tRNA: Protien: