1 / 19

Outline five different molecular mechanisms that give rise to genomic mutations

Outline five different molecular mechanisms that give rise to genomic mutations Illustrate your presentation with examples of genetic disorders caused by these mutations. MRCPath Part I Exam Self Help Course. 6 th Nov 2008. Genomic Mutation. Definition of Mutation:.

liberty-spencer
Télécharger la présentation

Outline five different molecular mechanisms that give rise to genomic mutations

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Outline five different molecular mechanisms that give rise to genomic mutations Illustrate your presentation with examples of genetic disorders caused by these mutations MRCPath Part I Exam Self Help Course. 6th Nov 2008

  2. Genomic Mutation Definition of Mutation: • Any change in the nucleotide sequence or arrangement of DNA Categories of Mutation: • Mutations that affect the number of chromosome : genome mutation • Mutations that alter the structure of chromosome : chromosome mutation • Mutations that alter the individual gene : gene mutation Type of Mutation: • Spontaneously • Induced

  3. Gene Mutation • Base substitution • Base replacement Caused by normal base changes it’s isoform Caused by normal base analog induced mispairing • Base alteration Caused by chemical reagents that can modify the base Caused by naturally happened deamination or depurination that can modify normal base • Base damage Caused by reagents that can damage DNA in such a way that replication is blocked. • Insertion // deletion (indelmutation) • Replication slippage • Base analog - intercalating

  4. The mechanism of base substitution Normal forms of the bases H3C H3C H H O O N N 5 5 4 4 6 6 H H 5 5 H H H H 4 4 6 6 N N 1 1 3 3 N N N N 2 2 1 1 3 3 N N N N 2 2 H H N N 6 6 N N 7 7 5 5 1 1 O O 8 8 O O 4 4 2 2 9 9 3 3 Cytosine Guanine Thymine Adenine N N N N O O N N H H Pairing between normal forms of the bases 6 6 N N 7 7 5 5 1 1 8 8 4 4 2 2 H H 9 9 3 3 N N N N N N H H C - G T - A

  5. The mechanism of base substitution Base replacement 1 H3C H H O N N 5 4 6 H H 5 5 H H H H 4 4 6 6 N N 1 3 N N 2 1 1 3 3 N N N N 2 2 H N N 6 6 N N 7 7 5 5 1 1 O 8 8 O O 4 4 2 2 These bases in DNA can appear in one of the several forms keto 9 9 3 3 Cytosine Guanine Thymine Adenine N N N N O N H By changing the position of their atoms and also in the bonds between atoms 6 N 7 5 1 imino or enol 8 4 2 H 9 3 N N N H H N 5 4 T : A > C : G 6 1 3 N N 2 H O Cytosine Cytosine Adenine imino keto

  6. The mechanism of base substitution Base replacement 2 Br Br H3C O O O 5 5 5 4 4 6 6 4 6 H H 1 1 N 1 3 3 3 N N N N 2 2 N N 2 H H H N 6 (Adenine) 5-bromouracil N 7 (Thymine) 5 O O 1 O 8 2 4 9 3 N N O N H 6 N 7 5 1 8 A : T > G : C 4 2 H 9 3 Br N N N G : C > A : T H O- 5 4 6 (Guanine) 1 3 N N 2 A : T > G : C H 2-aminopurine (2-AP) is an analog of adenine G : C > A : T O

  7. The mechanism of base substitution Base alteration Thymine Guanine H3C CH3 H3C H3C O Guanine N H O O 5 5 6 N 7 4 4 5 6 6 1 8 1 1 4 3 3 2 N N N N H 9 2 2 3 N H H N N H O O G : C > A : T EMS O N H Thymine 6 N 7 5 1 8 4 2 H 9 3 N N N T : A > G : C H

  8. The mechanism of base substitution Base alteration H N O 5 5 H 4 6 4 6 1 3 1 N 3 N 2 N N 2 Cytosine Uracil Pair with adenine H Deamination O O G : C – A : T H H3C H3C N O 5 5 4 6 H 4 6 1 3 1 3 N N 2 N N 2 5-Methylcytosine Thymine Pair with adenine H O O

  9. Base substitution Diseases caused by base substitution Hereditary Hemochromatosis : Cys > Tyr TGT or TGC > TAT or TAC G > A Cystic fibrosis: Gly > X (542) GGA, GGC, GGG or TGC > TAG, TGA or TAA G > T Base replacement or base alteration

  10. Insertion // deletion (indel mutation) • Replication slippage • Base damange • Base analog induced intercalating

  11. Insertion // deletion (indel mutation) • Replication slippage 5’ C G T T T T G G G G G C C C C C A A A A A A A A A A A A A A A A A A A A A A A A A C C C C C G G G G G T T T T T A A A A A C C C C C 3’ 3’ 3’ 3’ 3’ T T T T 5’ C G T 5’ C G T T T T 5’ C G T T T T T G C A T G 5’ C G T T T T T G C A T G A A G C A A A A C G T A C 3’ 5’ C G T T T T T G C A T G T When slippage happened within newly synthesised strand insertion

  12. Insertion // deletion (indel mutation) • Replication slippage 5’ C G T T T T T T 5’ C G G G G C C C A A A A A A A A A A A A A A A C C C G G G T T T A A A C C C 3’ 3’ 3’ 5’ C G T T T G C A A A A C G T A C 3’ A 5’ C G T T T T G C A T G G C A A A A C G T A C 3’ A 5’ C G T T T T T G C A T G 5’ C G T T T G C A T G T A G C A A A C G T A C 3’ When slippage happened within template strand deletion

  13. Insertion // deletion (indel mutation) Diseases caused by indel mutation • Insertion : Trinucleotide disease • Deletion : Epidermerlysis Bullosa Dystrophic (DEB) COL7A1 GGTCTGCAGGGTCCAAGAGGCCCCCCTGGCCCAGTG (exon 80)

  14. Insertion // deletion (indel mutation) • Base damage A number of chemical reagents including UV light can damage one or more bases UV light Take UV light as example UV light generates a number of distinct types of alterations in DNA, call Photoproduct by stimulate the formation of a cyclobutyl ring between two adjacent pyrimidines Such structure interfere block DNA synthesis No specific base pairing is possible Results in replication blockage Such replication blockage can be bypassed by insertion non-specific bases. This damage can cause base substitution as well as small or large fragment shift

  15. Insertion // deletion (indel mutation) Diseases caused by indel mutation Duchenne muscular dystrophy (DMD) • Deletion (large fragment) : 508delPhe , hot spot mutation in CFTR gene, cystic fibrosis • Deletion (small fragment): • Insertion // deletion : BRCA 1 & BRCA 2 genes BRCA1 : 185delAG and 5382insC BRCA2 : 999del5 and 6174delT • Base damage: Sickle cell disease Glu 6 Val (B-Globin gene) GAA or GAG GTA or GTG A > T

  16. Chromosome Rearrangement Type of rearrangement • Deletion : When a chromosome fragment is lost; Balanced rearrangement Unbalanced rearrangement • Duplication : When a chromosome fragment is doubled; Change the chromosomeal gene order but do not remove or duplicate and DNA Change the gene dosage of chromosome fragment • Inversion : When a chromosome fragment is in a opposed orientation; • Translocation : When a chromosome fragment is moved to a different chromosome;

  17. Chromosome Rearrangement The mechanism of the rearrangement DNA double strand break Repair The first event in the production of chr. rearrangement is the generation of two or more double-strand breaks in the chr. of a cell Double-stranded breaks are potentially lethal, unless they are repaired Repair systems in the cell correct the double-stranded breaks by joining broken ends back together If the two ends of the same breaks are rejoined, the original DNA sequence is restored. However, if the ends of two different breaks are joined together, one result will be one or other type of chr. rearrangement. A B C D A B C D A C B D A B C D A B C D A B C D A B B C D Inversion A C D Translocation Deletion Duplication

  18. Chromosome Rearrangement The mechanism of the rearrangement DNA double strand break Repair • The only chr. Rearrangement that survive meiosis are those that produce DNA molecular that have one centromere and two telomeres; • If a rearrangement produce a chr that lacks a centromere, such chr will not be incorporated into either progeny nucleus. Therefore, it is not inherited; • If a rearrangement produce a chr that has two telomeres, such chr will not be incorporated into either progeny nucleus. Therefore, it is not inherited • If a rearrangement produce a chr that lacks a telomeres, such chr will not be incorporated into either progeny nucleus. Therefore, it is not inherited • In a unbalanced rearrangement, the larger the fragment that is lost or duplicated, the more likely it is the gene(s) located in that fragment will cause phenotypic abnomalities.

  19. Chromosome Rearrangement Diseases caused by Chromosome Rearrangement • Deletionof one of the a-globin gene in a-thalassemia • Duplicationof several exons of the low-density lipoprotein receptor gene mediate by Alufamily repeat located in the intron of the low-density lipoprotein receptor gene: familial hypercholesterolemia • Inversionof exon 23 – 26 in the factor VIII gene due to separating of exon 1 – 22 from exon 23 – 26 of factor VIII gene leads to the inactivation of factor VIII protein, which is the cause of Hemophilia A. • translocationbetween 9q34 and result in fusion gene BCR-Abl is the cause of Chronic myelogenousleukemia (CML).

More Related