1 / 13

Role of S-layer proteins in probiotic activity of Lactobacillus strains

The 2nd International Symposium „VERA JOHANIDES” BIOTECHNOLOGY IN CROATIA by 2020 Zagreb, May 10-11, 2013. Role of S-layer proteins in probiotic activity of Lactobacillus strains. Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković

lindsey
Télécharger la présentation

Role of S-layer proteins in probiotic activity of Lactobacillus strains

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. The 2nd International Symposium „VERA JOHANIDES” BIOTECHNOLOGY IN CROATIA by 2020 Zagreb, May 10-11, 2013 Role of S-layer proteins in probiotic activity of Lactobacillus strains Jasna Beganović, Ksenija Uroić, Andreja Leboš Pavunc, Blaženka Kos, Jagoda Šušković Laboratory for antibiotic, enzyme, probiotic and starter cultures technology Department of Biochemical Engineering Faculty of Food Technology and Biotechnology, University of Zagreb, Croatia

  2. Strategy for theselection of probiotic strainsin Laboratory for antibiotics, enzymes, probiotics and starter cultures technology (Šušković et al., 1992.) Accurate taxonomic identifications BCCM confirmed taxonomic nomenclature of our 9 selected strains: Lactobacillus helveticus M92, L. plantarum L4, L. brevis D6, L. brevis ZG1, L. brevis SF9B, L. paraplantarum SF15B, L. fermentum A8, Enterococcus faecium L3, E. faecium A7… General Biosafety GRAS (Generally Regarded As Safe, according US FDA) status of selected strains Resistance to pH, gastric juice bile, pancreatic juice (Antibiotic susceptibility) PhD Thesis (Šušković, 1996) PhD Thesis (Šušković, 1996) Master Thesis (Kos, 1995) PhD Thesis (Uroić, in progress) Activity and viability Technological (production/processing) PhD Thesis (Šušković, 1996) Master Thesis (Frece, 2003) PhD Thesis (Leboš Pavunc, 2012) Antimicrobial activity Antagonism to pathogens PhD Thesis (Kos, 2001) PhDThesis (Uroić, in progress ) PhD Thesis (Beganović, 2008) Adherence to intestinal epithelium/tissue Functional aspects PhD Thesis (Šušković, 1996) PhD Thesis (Kos, 2001) PhD Thesis (Leboš Pavunc, 2012) Influencing metabolic activities PhD Thesis (Frece, 2007) PhD Thesis (Beganović, 2008) PhD Thesis (Uroić, in progress) Stimulation immune response

  3. Characteristics of Lactobacillus S-layer proteins • monomolecular crystalline arrays composed of (glyco)proteins • located on external side of cell envelope • identified in different microorganisms from the domains of Bacteria and Archaea • detectedin just a few strains among 117know Lactobacillusspecies: • lower MW : 25-71 kDa • highly basic proteins (pI = 9.35-10.4) • mostly non-glycosylated • signal peptide (N- terminal secretion signal ) typical for Sec pathway (25-30 AA) cell membrane cell wall S-layer S-layer present on the L. brevis D6 cell surface performed by transmission electron microscopy (PhD in progress, Ksenija Uroić)

  4. 1 2 S Detectionof S-layerproteinsofLactobacillusstrains fromLaboratoryofantibiotics, enzymes, probioticsand starter culturestechnology SDS-PAGE surface protein profiles slpA gene (GenBank acession number HM140425) S-layer proteins: L. paraplantarum SF15B L. brevis D6 L. brevis ZG1 L. brevis SF9B PCR analysis with the specific primers ATGAAGAAAAATTTAAGAAT and CACCGATCTTGTAGTA. 1.L. helveticusM92 2.L. plantarumL4 S-DNA standard

  5. L. helveticus M92 S-layer protein identified by SDS-PAGE coupled to LC-MS/MS (LC-MS/MS) nESI linear ion trap-MS S 1 SlpA protein Nano HPLC Peptide separation S – low MW protein standard; 1 – S-layer, purified by dialysis Peptide sequences assigned to SlpA protein by Bioworks 3.2. Beganović et al., (2010) Journal of Proteomic Research, 9 (2): 677-688 Beganović et al., (2011) Antonie van Leeuwenhoek,100 (1): 43-53

  6. Role of S-layer proteins in probiotic activity of Lactobacillus strains 1. Adhesionof Lactobacillusstrainsto IPEC-1 cell line(porcine intestinal epithelial cells) Lactobacillusstrains are labeled by thymidine and theradioactivity of the samples was measured by liquid scintillation (L. helveticus M92 as reference strain)

  7. Role of S-layer proteins in probiotic activity of Lactobacillus strains 2. Inhibition of adhesion of enterotoxigenic Echerichia coli toIPEC-1 cell lineby Lactobacillus strains - COMPETITION - simultaneous addition of Lactobacillus and E. coli ERL 2055 - DISPLACMENT -additionofLactobacillusafterincubation ofE. coli ERL 2055 - EXCLUSION - additionofLactobacillusbeforeincubation of E. coli ERL 2055

  8. Role of S-layer proteins in probiotic activity of Lactobacillus strains 3. Imunomodulation mediated byLactobacillus purified S- layer proteins • Extraction of S-layers from Lactobacilluscell surface 1 2 3 4 5 6 1 2 3 4 5 6 1 - L. brevis GRL1 2 - L. amylovorus GRL 1110 3 - L. amylovorus GRL 1111 4 - L. amylovorus GRL 1112 5 - L. helveticus M92 6 – L. plantarumD6

  9. Induction of IL-1, IL-6, IL-10, IL-12, TNF cytokines production in human monocyte-derived dendritic cellswith Lactobacillus strains and purified S-layer proteins - determined by cytokine specific ELISA

  10. Stimulationof HEK Blue cell lines -TLR2, TLR4, TLR5 and NOD2- with Lactobacillus strains and purified S-layer proteins

  11. Maturation of dendritic cells in response to Lactobacillus bacterial cells and purified S-layer proteins analysed by Flow Cytometric Analysis (FACS) Bacteria/S-layer proteins induced expression of moDC maturation markers HLA class II, CD86 and CD83

  12. BiotechnologicalprotocolinLaboratoryfor antibiotics, enzymes, probiotics and starter cultures technology, for probioticand starter cultureproductiontechnology Collectionoflacticacidbacteria (ZBMK) overthan 300 characterised LAB strains Inoculation Phenotypiccharacterisationprobioticstrain / starter culture Inoculum Growthmedium Productionprocesscontrol: - microbiologicalcontrol - geneticcontrol Growth Sterilisation Nutrientmediumremoval Wetbiomassofprobiotic / starter culture lyoprotectantaddition MICROENCAPSULATION LYOPHILIZATION microbiologicalcontrolgeneticcontrol MIKROENCAPSULATION microbiologicalcontrolgeneticcontrol functionalitycontrol Probioticbacterium/ starter culture

  13. SCIENTIFIC PROJECTS & COLLABORATIONS: • National scientificproject “Probiotics, prebioticsandfunctional starter cultures” No. 058- 1990-2007 • Internationalproject SEE-ERA.NET PLUS: PSALAB No. 195/1 Project leader: PhDJagodaŠušković, full prof. • Collaborativeproject withresearchteamofPhDAiriPalva, prof., University of Helsinki, Finland

More Related