1 / 5

Hybridization of Nucleic Acids

Hybridization of Nucleic Acids. DNA1. DNA2. RNA. Probe. Northern hybridization. Southern hybridization. Juang RH (2004) BCbasics. Preparation of Traditional Nucleic Acid Probe. Amino acid sequence. GLY-ASP-GLU-SER-SER-VAL-LEU-----. GGG-GAC-GAG-TCC-TCC-GTT-CTC---.

lotus
Télécharger la présentation

Hybridization of Nucleic Acids

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Hybridization of Nucleic Acids DNA1 DNA2 RNA Probe Northern hybridization Southern hybridization Juang RH (2004) BCbasics

  2. Preparation of Traditional Nucleic Acid Probe Amino acid sequence GLY-ASP-GLU-SER-SER-VAL-LEU----- GGG-GAC-GAG-TCC-TCC-GTT-CTC--- Nucleic acid sequence * ** * * * * * Codon degeneracy The nucleic acid sequence is Deduced from amino acid sequence Synthesizing oligonucleotide Chemical synthesis PROBE:GGGGACGAGTCCTCCGTTCT Juang RH (2004) BCbasics

  3. Probe is labeled with radioactive 32P Hybridization DNA denaturation Target gene Single colony Lysed Juang RH (2004) BCbasics

  4. Colony Is Screened by Hybridization with Probe Colony hybridization Cover with filter paper Transferring … Collect filter paper Autoradiography Dissolve cell DNA denatured Add probe Juang RH (2004) BCbasics

  5. Biochip Based on Hybridization Sample DNA Complementary DNA hybridize Biochip Each spot contains known DNA Signal appears Schena (2000) Microarray Biochip Technology, p. A31 Juang RH (2004) BCbasics

More Related