1 / 38

PFGE and Beyond: PulseNet in the Next Decade

PFGE and Beyond: PulseNet in the Next Decade. Bala Swaminathan, Ph.D. Centers for Disease Control and Prevention. Why Next Generation Subtyping Methods?. PFGE (and other RFLP-based methods) are difficult to standardize

mara-peters
Télécharger la présentation

PFGE and Beyond: PulseNet in the Next Decade

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. PFGE and Beyond: PulseNet in the Next Decade Bala Swaminathan, Ph.D. Centers for Disease Control and Prevention

  2. Why Next Generation Subtyping Methods? • PFGE (and other RFLP-based methods) are difficult to standardize • Comparability of patterns within and between laboratories requires strict adherence to a standard protocol • Normalization of patterns is complex • PFGE is labor-intensive and requires high concentrations of a pure culture • In some instances or for some pathogen groups, discrimination may not be adequate

  3. Clinical isolate clusters with no demonstrable epidemiologic links – Example 1

  4. Clinical isolate clusters with no demonstrable epidemiologic links – Example 2

  5. .............. Requirements for the next generation subtyping method for PulseNet • Broad applicability • Rapid results (< 24 h) • Inexpensive • Better discrimination than PFGE • Quantitative relatedness between strains • Accurate snapshot of the genome diversity • Backward compatibility with PFGE data • Easy to perform on a routine basis • Amenable to automation • Results should be readily comparable within and between laboratories

  6. Methodologic Approaches • Multi-locus sequence typing (MLST) • Multi-locus Variable-Number Tandem Repeat Analysis (MLVA) • High throughput SNP analysis

  7. Multi-Locus Sequence Typing • Based on the nucleotide sequence of internal regions of housekeeping loci • Housekeeping loci should be conserved with only minimal nucleotide changes due to conserved protein function • Multiple loci are targeted in this subtyping method • Sequence variation allows for the assignment of alleles Isolate A – ATTCGGCAT – allele 1 Isolate B – ATTCGCCAT – allele 2 • A combination of alleles for all loci provides an allele profile which can then be assigned to a sequence type (ST) Isolate A (1, 5, 6, 3, 4, 3, 1) ST-5 Isolate B(1, 5, 6, 3, 3, 3, 1) ST-51 • Sequence types are grouped into clonal complexes based on similarity to a central allelic profile

  8. Subtyping Campylobacter jujuni • Three published MLST schemes • Dingle at al (2001) • 194 isolates • 155 sequence types • 51 unique ST’s • Suerbaum et al (2001) • 32 isolates plus NCTC 11168 • 31 unique allele profiles • Frequent recombination • Manning et al (2003)

  9. Origin of replication glt asp tkt unc MLST loci nuoH pgm atpA yphC gly fumC 1,641,481 bp eftS asd ddlA gln

  10. Subtyping Campylobacter jujuni Sails et al (2003) • Comparison of MEE, MLST and PFGE • MLST is not as discriminatory as PFGE • MLST plus a variable locus • MLST and flaA SVR provides similar discrimination to PFGE

  11. MLST studies with enterics • Listeriamonocytogenes: Additional variable gene targets need to be included in MLST (MLST+) to obtain acceptable discrimination • Cai et al. 2002 • Zhang et al. 2004 • Salmonella enterica (Kotetishvili et al, 2002) • MLST is more discriminatory than PFGE • Escherichiacoli (Whittam Laboratory) • Distinguish pathovars of E. coli/Shigella groups • Distinguish clonal lineages within pathovars • E. coli O157:H7 is too clonal for MLST subtyping (Noller et al, 2003)

  12. TAACCG Isolate A TAACCGTAACCG Isolate B TAACCGTAACCGTAACCGTAACCG Isolate C TAACCGTAACCGTAACCGTAACCGTAACCG Isolate D Multilocus VNTR Analysis(MLVA) • MLVA (Multi Locus VNTR Analysis) • Variable Number Tandem Repeats (VNTRs) • Conserved repeat motif found in the genome • Example: TAACCG • Variable numbers of repeat units among isolates of the same species • MLVA examines the number of repeats at multiple loci to determine genetic relationships

  13. Development of E. coli O157 MLVA protocol • Contract awarded to the Massachusetts Department of Public Health / State Laboratory Institute in fall 2001 • Collaboration with Dr. Paul Keim (The Northern Arizona University)

  14. Development of E. coli O157 MLVA protocol (cont’d) • Keys, C., S. Kemper, and P. Keim. 2005. Highly diverse variable number tandem repeat loci in the E. coli O157:H7 and O55:H7 genomes for high-resolution molecular typing. J. Appl. Microbiol. 98: 928-940. • 29 VNTR loci polymorphic in O157:[H7] serotype identified

  15. MA protocol based on 25 VNTR loci Amplified in four multiplex PCR reactions Fluorescently labeled PCR amplicons sized using capillary electrophoresis system (CEQ 8000, Beckman Coulter, Fullerton, CA) Internal validation at the CDC PulseNet Methods Development and Validation Laboratory started in summer 2004 Development of E. coli O157 MLVA protocol (cont’d)

  16. E.coli O157 strains used in the initial validation • 152 isolates analyzed by both MLVA and PFGE using XbaI • Geographically diverse sporadic isolates with unique XbaI PFGEpatterns (UPP collection) • Outbreak isolates from eight well characterized outbreaks • Epidemiologically unrelated isolates clustered by PFGE • A subset of 54 isolates were further characterized with BlnI

  17. Nine VNTR loci included in the final MLVA protocol for E. coli O157 1Vhec loci are form Lindstedt et al. (2003); TR loci are from Noller et al. (2003)

  18. MLVA protocol steps • Boiled whole cell DNA templates prepared from overnight cultures • Nine VNTR sites amplified in three PCR reactions • Diluted (1:60) PCR products mixed with sample loading solution and 600 bp DNA size standard • PCR products sized using CEQ 8000 capillary electrophoresis system (Beckman Coulter) • Fragment list exported to BioNumerics (Applied Maths, Kortijk, Belgium) for analysis

  19. Discriminatory power of MLVA compared to PFGE • 152 isolates • 133 unique MLVA patterns • 126 unique XbaI PFGE patterns • A subset of 54 isolates were characterized by PFGE using two enzymes • 35 unique MLVA patterns • 39 unique XbaI-BlnI PFGE patterns

  20. Clustering of 152 E. coli O157:[H7] isolates by MLVA Cluster II Cluster I Sakai EDL933

  21. Clustering of 43 E. coli O157:[H7] isolates by MLVA and by PFGE using combined XbaI-BlnI data MLVA II MLVA Ib MLVA Ia PFGE III PFGE I PFGE II

  22. Clustering of outbreak isolates and some selected sporadic isolates by MLVA GA water park outbreak CT apple cider outbreak CO outbreak NJ outbreak Western States outbreak WI restaurant outbreak NY County Fair MI outbreak

  23. Clusters 0411ml-1c and 0501ml-1c – PFGE pattern combination EXHX01.0086/EXHA26.0576

  24. Conclusions from the on-going validation of the E. coli O157 MLVA protocol • Overall, MLVA slightly less discriminating than PFGE with two enzymes • MLVA can further discriminate some of the most common PFGE patterns • Epidemiological congruence of the MLVA data better than that of PFGE • Development of interpretation guidelines may pose a challenge

  25. Future plans • 2005: • Complete the CDC internal validation of the E. coli O157 MLVA protocol • Custom-made 1 kb standard for the locus VNTR-10? • Reagent evaluation • Fine-tuning of the BioNumerics scripts • Begin collaborative validation of the E. coli O157 MLVA protocol by transferring the protocol to four PulseNet laboratories

  26. Future plans (cont’d) • 2006 • Expand the implementation of the protocol to at least four more PulseNet laboratories • Establish a national database with a pattern naming strategy • Establish interpretation criteria

  27. SNP-basedTyping of E. coli O157

  28. AAGGTTA ATGGTTA

  29. SNPs as genotyping markers • Unambiguous data • Easy to exchange/compare in database • Good potential for automation • Amenable to high-throughput platforms • Useful for long-term epidemiology/population genetics • Alternative for typing highly clonal species, serotypes

  30. E. coli O157 genes are highly conserved • Mosaic genome ~5.59Mb • Genomic diversity by PFGE & MLVA • >99.9% homology in orthologous genes • MLST didn’t work well for typing O157 • Noller et al: 7 housekeeping + 2 membrane protein genes • 77 isolates, >18 PFGE types, 2 STs • (1 SNP in ompA) • Foley et al: 7 virulence + 1 housekeeping genes • 92 isolates, 72 PFGE types, 5 STs • (2 SNPs in eaeA, 1 in hlyA, 10 in uidA)

  31. In silico genome comparison • Anchor Sakai query EDL933 • Most genes are 100% identical • ~100 loci bearing SNPs • (phageborne, sequencing errors, • or paralogous…) • Need a better strategy to identify • novel SNPs http://www.genome.wisc.edu/ http://genome.gen-info.osaka-u.ac.jp/ http://colibase.bham.ac.uk/ http://snpsfinder.lanl.gov/

  32. NimbleGen CGR microarray Mutation Mapping Resequencing Singh-Gasson et al. 1999. Nat. Biotechnol. 17:974-978 Nuwaysir et al. 2002. Genome Res. 12:1749-1755

  33. Selection of genes for CGR • Conserved among different E. coli O157 isolates • Single-copy in the genome • Re-sequencing capacity per slide ~1.2Mb (~1,200 genes) • 376 O157-specific genes in 95 “size-conserved” • S-loops (including many virulence factors) • ~69 housekeeping genes with putative SNPs • 754 additional backbone genes randomly-selected • throughout the entire genome • Large virulence plasmid (pO157) Ohnishi et al. 2002. PNAS. 99:17043-17048

  34. O157 strains for resequencing

  35. Total no. of SNPs in test strains = 836 No. of unique SNPs common in G5101 & 493/89 =138 * Average SNPs between any of two O157:H7 = 65 * No. of informative SNPs to differentiate between any of two O157:H7 = 139

  36. Polymorphic genes/regions: • 836 SNPs in 503 genes, 65 gene >3 SNPs • ECs1934: backbone, putative exonuclease VIII (RecE) • prophage CP-933U 22 SNPs • ECs1205: Shiga-toxin II subunit A (6 SNPs in 960-bp) • ECs1206: Shiga-toxin II subunit B (0 SNPs in 270-bp) • ECs2973-2974: Shiga-toxin I (1 SNP in subunit B) • Conserved genes/regions: • S-loops related to adhesion/invasion • LEE (Locus of enterocyte enfacement) Type III secretion system • Backbone regions, i.e. between S270-S276

  37. Data analysis in progress: • Backbone vs. S-loops • Transition vs. transversion • Synonymous vs. non-synonymous • Insertions/deletions • Phylogenetic analysis

  38. Conclusions • PFGE will continue to be an essential subtyping method for PulseNet • MLVA may provide additional discrimination for E. coli O157:[H7] and some Salmonella serotypes • MLVA protocol for E. coli O157 :[H7] will be transferred to selected PulseNet laboratories in 2005 • SNP is the subtyping method of the future; SNP may be used in combination with MLVA • Much work needs to be done on new subtyping methods for PulseNet

More Related