1 / 1

miR159 target : U21_3667 (GAMYB) 4/4 ↓

miR159 target : U21_3667 (GAMYB) 4/4 ↓ GAAGATGGAGCTCCCT T CACTCCAAGATACCG miR156 target : U21_18637 (SPL) 3/4 ↓ CGGACTGTGCTCTCTC T CTTCTGTCAGCTCCG miR164 target : U21_9757 (NAC) 2/3 1/3 ↓ ↓

margo
Télécharger la présentation

miR159 target : U21_3667 (GAMYB) 4/4 ↓

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. miR159 target : U21_3667 (GAMYB) 4/4 ↓ GAAGATGGAGCTCCCTTCACTCCAAGATACCG miR156 target : U21_18637 (SPL) 3/4 ↓ CGGACTGTGCTCTCTCTCTTCTGTCAGCTCCG miR164 target : U21_9757 (NAC) 2/3 1/3 ↓ ↓ GGCGGCGCACGTGACCTGCTTCTCCAACAACG Figure S5: Results of RLM-5’RACE for three targets of known miRNAs . The sequences correspond to the 36 bp TSS of each target, the base in green shows the 5’end position of the corresponding degradome signature. Numbers in red refer the ratio of 5’-RACE clones matching the site indicated by an arrow over the total number of clones sequenced.

More Related