1 / 34

DNA Deoxyribonucleic Acid The Blueprint of Life

DNA Deoxyribonucleic Acid The Blueprint of Life. Biology I Searcy Ninth Grade Center. Oswald Avery ( 1944) Discovered that the nucleic acid DNA stores and transmits the genetic information from one generation of an organism to the next. Where have scientists been ? A brief history.

marthalowe
Télécharger la présentation

DNA Deoxyribonucleic Acid The Blueprint of Life

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNADeoxyribonucleic AcidThe Blueprint of Life Biology I Searcy Ninth Grade Center

  2. Oswald Avery (1944) • Discovered that the nucleic acid DNA stores and transmits the genetic information from one generation of an organism to the next Where have scientists been?A brief history

  3. Alfred Hershey & Martha Chase(1952) • Concluded that the genetic material of the bacteriophage was DNA, not protein. • Used radioactive phosphorous and sulfur.

  4. Erwin Chargaff (1950) • Discovered a relationship in the nitrogenous bases • Adenine (A) = Thymine (T) • Guanine (G) = Cytosine (C)

  5. Rosalind Franklin (1952) • Took an x-ray of the DNA structure so the patterns could be seen. • The x-rays show that DNA is twisted around each other like a helix and has two strands.

  6. James Watson & Francis Crick (1953) Studied the structure of DNA by building a 3-dimentional model of the molecule after using clues from Franklin’s x-ray of DNA.

  7. Watson and Crick proposed that DNA is made up of 2 chains of nucleotides held together by nitrogenous bases & that the 2 strands are twisted together in a shape called a double helix.

  8. DNA is a polymer made up of repeating monomers of nucleotides. • DNA determines an organism’s traits by controlling the manufacturing of proteins. • The sequencing of nucleotides forms unique genetic information. The Structure of DNA

  9. The nucleus of a cell contains chromosomes

  10. Which are made up of coiled DNA

  11. Eukaryotic chromosomes contain DNA wrapped around proteins called Histones. Chromosome Solenoid Histone Proteins DNA Double Helix

  12. Each strand of DNA is made up of subunits called Nucleotides

  13. Each nucleotide is constructed of 3 parts: a PHOSPHATE group, A SUGAR molecule & 1 of 4 nitrogen bases Adenine (A) Guanine (G) Cytosine (C) Thymine (T) Purines Pyrimidines

  14. Because of the hydrogen bonds, Adeninecan only bond with Thymine& Guaninecan only bond with Cytosine *A purine is always paired with a pyrimidine. Adenine Thymine Guanine Cytosine

  15. This is known as COMPLEMENTARY base pairing

  16. For example: • GCA ATC TA • CGT TAG AT Now you try: CCA GAT TGA GGT CTA ACT

  17. What 2 scientists constructed a model of DNA and published their results in 1953? • If one strand of DNA read ATC GTA, what would the other strand read? Mini Quiz

  18. DNA Replication

  19. Copying process by which a cell duplicates its DNA • DNA molecule separates into two strands, then produces two new complementary strands following the rules of base pairing • Each strand of the double helix of DNA serves as a template for the new strand DNA Replication

  20. Enzymes unzip DNA by breaking the hydrogen bonds between the base pairs, which produces two replication forks • DNA polymerase • Joins individual nucleotides to make a new strand • Proofreads each new strand How Replication Occurs

  21. DNA remains in the nucleus, but in order for it to get its instructions translated into proteins, it must send its message to the ribosomes where proteins are made. The chemical used to carry this message is Messenger RNA. RNA & Protein Synthesis

  22. RNA:Ribonucleic Acid • 3 Types of RNA: • mRNA=Messenger RNA: FX: Carry the genetic information out of the nucleus for protein synthesis • tRNA=transfer RNA: FX: decode the information by transferring the amino acid to the ribosome as it is specified by coded messages in mRNA • rRNA=Ribosomal RNA: constitutes 50% of a ribosome, which is the site of protein synthesis.

  23. RNA … • Has one strand instead of two strands. • Has uracil instead of thymine. • Has ribose instead of deoxyribose. RNA is Similar to DNA Except

  24. mRNA has the job of taking the message from the DNA to the nucleus to the ribosomes. • Transcription- RNA is made from DNA • Translation- Proteins are made from the message on the RNA

  25. Ribosome TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla Protein ? aa aa aa aa aa aa aa aa How can you code for 20 amino acids withonly 4 DNA bases (A,U,G,C)? How does mRNA code for proteins?

  26. Ribosome TACGCACATTTACGTACGCGG DNA Codon AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla Protein mRNA Codes for Proteins in Triplets Codon = block of 3 mRNA bases

  27. The mRNA Code • For ALLlife! • strongest support for a common origin for all life • Code has duplicates • several codons for each amino acid • mutation insurance! • Start Codon • AUG • methionine • Stop Codons • UGA, UAA, UAG

  28. mRNA A C C A U G U C G A U C A G U A G C A U G G C A U A C G G U tRNA tRNA A G aa U A G tRNA aa aa aa tRNA aa aa • The working instructions  mRNA • The reader  ribosome • The transporter  transfer RNA (tRNA) mRNA to protein = Translation Ribosome C

  29. aa aa aa aa A C C A U G U C G A U C A G U A G C A U G G C A aa aa aa tRNA aa From Gene to Protein Nucleus Transcription Translation DNA mRNA Protein Ribosome Trait Cytoplasm

  30. Cytoplasm Protein Nucleus Transcription Translation Trait

  31. Protein Transcription Translation

More Related