1 / 21

videos.howstuffworks/hsw/24990-genetics-understanding-dna-video.htm

http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm Understanding DNA : How Stuff Works. DNA BASE PAIRS. Genetic Variation : A Key to Survival. GENETIC VARIATION leads to Adapt ation. RESISTANT STRAIN.

masao
Télécharger la présentation

videos.howstuffworks/hsw/24990-genetics-understanding-dna-video.htm

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. http://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htmhttp://videos.howstuffworks.com/hsw/24990-genetics-understanding-dna-video.htm Understanding DNA: How Stuff Works

  2. DNA BASE PAIRS

  3. GeneticVariation:A Key to Survival

  4. GENETIC VARIATION leads to Adaptation

  5. RESISTANT STRAIN How do malaria parasites survive anti-malaria medications?

  6. How Do CellsReproduce? http://luigigalvani5.blogspot.com/2008/...ary.html http://waynesword.palomar.edu/lmexer2a.htm Different copy Identical copy

  7. Mixing of Genes CROSSING OVER

  8. MINI-LAB: Observing cell reproduction • Mount a prepared slide of a cell undergoing cell division. 2. Draw the cell and label the ff structures: a. cell membrane b. chromosomes 3. Describe what you see. • Note: Follow guidelines on • Making Diagrams • Accurate representation • 2-D diagram • Proper labels • Neatly presented

  9. Crossing over: Why we are different from our parents VC; Where do genes come from

  10. From Geneto Protein: An exercise in breaking the code

  11. DNA COPIES ITSELF:Base pairings: A- T C – GDNA moleculeunzips breaking the base pairs forming 2 sides VC: DNA Replication

  12. A: TACCGGATGCCAGATCAAATCWhat is the other side?__________________________ Given the code of a DNA molecule, what would be the code of the new DNA strand? B: TACGGGGGCGTAACCACAACTWhat is the other side?__________________________

  13. VC: How DNA copies itself From DNA to protein

  14. 2.CODE IS READ. The code of the new strand (DNA copy) is READwith theT replaced with a new base Uracil or U. A: ____________________________________ B: ____________________________________

  15. 3. CODE IS TRANSLATED. The code is read in groups of 3 called codons). A: ____________________________________ B: ____________________________________

  16. Find the Amino Acid sequence that is coded: Use the following guide. A: ____________________________________ B: ____________________________________

  17. New copy (RNA) is read and translated Genes(DNA) Make copies of itself Crossover (mixing of code) www.squidoo.com/geneticsresearch Amino acids (protein) are formed A trait is expressed VC: What is phenotype

  18. Cracking the Code DNA VC: Cracking the code copied and read RNA translated http://entomology.wisc.edu/~goodman/wgr...rch.html PROTEIN

  19. While the copying of DNA is a very accurate process, what happens when a letter is altered? VC: DNA Mutation

  20. A: TACCGGATGCCAGATCAAATCWhat is the other side? Given the code of a DNA molecule, what would be the code of the new DNA strand? AT_GCCTACGGTCTAGTTTAG B: TACGGGGGCGTAACCACAACTWhat is the other side?ATGCGCCCGCATTGGTGTTGA

More Related