240 likes | 541 Vues
Unlocking the mystery of DNA. Prior to the 1950’s. What we knew: Inherited characteristics are determined by genes Genes are passes from one generation to the next Genes are part of a chromosome Chromosomes are made of protein and DNA. Cell division and DNA replication. Cells divide.
E N D
Prior to the 1950’s What we knew: Inherited characteristics are determined by genes Genes are passes from one generation to the next Genes are part of a chromosome Chromosomes are made of protein and DNA
Cell division and DNA replication • Cells divide • Growth, Repair, Replacement • Before cells divide, they have to double cell • structures, organelles and their genetic • information
But… What did DNA look like, and how did it replicate itself?
Discovering the structure of DNA • Rosalind Franklin (1920-1958) • King’s College, London • Made significant advances in • x- ray diffraction techniques • with DNA • Her images suggested that • DNA had a spiral shape • One of her DNA images
Discovering the structure of DNA • Maurice Wilkins – (1916-2004) • King’s College, London • Also did X-ray diffraction studies • of DNA • Worked with Rosalind Franklin • Shared information with Watson and Crick
Discovering the structure of DNA • Erwin Chargaff – (1905-2002) • Columbia University, NY • Investigated the composition of DNA • His findings by 1950 strongly • suggested the base-pairings • of A-T & G-C • Met with Watson and Crick in • 1952 and shared his findings • “Chargaff’s rule” A = T & C = G
Discovering the structure of DNA • James Watson (1928) and Francis Crick (1916-2004) • Worked together at Cavendish Laboratory in Cambridge • to determine the structure of DNA • Used work from Franklin, Wilkins, and Chargaff to • determine the double helix shape • Watson, Crick, and Wilkins • were awarded the Nobel Prize • Rosalind Franklin passed away • (1958) before the Nobel Prize • was awarded in 1962
Discovering the structure of DNA • DNA = Deoxyribose nucleic acid • Present in all living cells • Contains all the information • Nucleotides: • a subunit that consists of: • a sugar (deoxyribose) • a phosphate • and one nitrogen base – 4 different bases • Adenine (A) and Thymine (T) • Guanine (G) and Cytosine (C)
DNA – What does my code look like? Computer Code: 10010100111010001100101001110010111100101001001001001011100101000101010010010100101010010010100101001010100101001010010101010101001010100101010111111100 DNA Code: ATTCGGGGCCTTAAGACATTAATTTCCCAAGAAGAGATAAACTAGAGAGACCCTTTAAAACACACAGAGATAGACAGAAAAACAATAGACAGATACAGATAGACATAAAAAATTTTTTGGGAAA…millions and millions of bases…
Practice DNA Base Pairs G A T T A C A C T A A T G T
DNA replication – two identical strands of DNA Original DNA strands
DNA replication Newly assembled DNA strands
DNA replication Semi-conservative replication