1 / 40

An Unsustainable Path

An Unsustainable Path. Better Prevention and Management of Chronic Disease are Critical to Improving Health Outcomes and Lowering Healthcare Costs. Source: DeVol, R, Bedroussian, A, et al. An Unhealthy America: The Economic Burden of Chronic Disease. The Milken Institute. October 2007. 2.

pahana
Télécharger la présentation

An Unsustainable Path

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. An Unsustainable Path Better Prevention and Management of Chronic Disease are Critical to Improving Health Outcomes and Lowering Healthcare Costs Source: DeVol, R, Bedroussian, A, et al. An Unhealthy America: The Economic Burden of Chronic Disease. The Milken Institute. October 2007. 2

  2. Our Leaders Agree “In the future, when doctors can truly prescribe the right treatment, to the right person, at the right time, we will have a new level of precision and effectiveness that will provide the knowledge-driven power that is necessary to achieve our highest goals in healthcare reform – including more effective disease prevention and early disease detection.” HHS Secretary Kathleen Sebelius Senate confirmation hearings, April 2, 2009 3

  3. IGNITE is a unique non-profit medical research institute in the national capital area aimed at alleviating human suffering and transforming the health care system using a new strategy: Personalized Medicine 4

  4. Strategy • Chronic disease R&D focus – align program with market needs from outset • Deep molecular sub-classification of chronic disease (all heritable risk identified) • Identify at-risk individuals from across the population via “genetic risk factor testing” • Run distributed primary prevention trials facilitated by HIT network • Apply results rapidly back to at-risk individuals via a robust translational infrastructure – including a “captured” health care system • Integrate health information technology to allow heritable risk information to be incorporated into point-of-care with clinical decision support • Empower change across the personalized medicine ecosystem through policy, education, health economics, regulation Outcome: Alleviate or delay the onset of chronic disease and decrease the time individuals are sick at the end of life and allow resources to care for more 5

  5. CASE STUDY: Alzheimer’s

  6. Alzheimer’s Disease 7

  7. How AD Contributes to the Crisis In ‘Boomer’ Diseases, such as Alzheimer’s, Impact and Costs Will Escalate Dramatically Without New Interventions $2000 16 Baseline Estimate 14 Delayed Onset & Slowed Progression (~6 yrs) $1500 12 10 Estimated Number of People With AD (in millions) $1000 8 6 $500 4 2 $0 0 2000 2010 2020 2030 2040 2050 Adapted from The Lewin Group Report, June 2004, “Saving Lives. Saving Money: Dividends for Americans Investing in Alzheimer Research,” The Alzheimer’s Association (http://www.alz.org/Resources/FactSheets/Lewin_FullReport1.pdf) 8

  8. Deep MOLECULAR SUB-CLASSIFICATION

  9. Molecular Scanning Technologies • Chairman of NIH Microarray Consortium (15 NIH) • 10 years of experience with Affymetrix platform • 5 years experience with Illumina • >60,000 expression profiles run • >100,000 SNP arrays run (10k, 100k, 500k, 1M) • Data warehousing • First “Genomics Collaborators” , “Center of Excellence”, and “TransMed” site of Affymetrix • NHLBI Programs in Genomic Applications • NEI intramural contract site • NIH Neuroscience Array Consortium • NCI funded ALL catalog • NIA funded Alzheimer’s disease catalog • ADNI Consortium hub • International Autism Genome Project Genotyping Site • TCGA Biospecimen repository • High throughput sequencing (Solexa, 454, ABI, Pacific Biosiences)

  10. The Shop

  11. NIH Neuroscience Microarray Consortium Total Projects: 455 (45,400 arrays) • 1650 registered users • 455 proposals submitted from about 114institutions around the country and from over 287 different investigators

  12. Population-wide screening

  13. Population-based Genetic Risk Factor ScreeningDavid Agus, MD Dietrich Stephan, PhDSAB:Isaac Kohane, MD PhDDavid Botstein, PhDSpencer Wells, PhD

  14. Extract the Total Heritable Risk for Chronic Disease 1 2 3 4 5 Customer Acquisition PersonalizedWeb Portal Ongoing Service Laboratory Bioinformatics ATACCGCTGGCCCTTTGGCATTACCTATGAAGATTGCTTCAGCCAGCGTCAGTTTCAACCTGTACGCTAGTGTGTTTCTACTCACGTGTCTCAGCATTGATCGATACCTGGCTATTGTTCACCCAATGAAGTCCC FUTURE: Full genome sequencing, copy number analysis, methylation status leading to personalized exposure mitigation strategies and biomarker monitoring programs fully integrated into the established health care system. Navigenics CONFIDENTIAL

  15. Non-Invasive DNA Collection Kit

  16. GMP-compliant, ISO-certified Array Manufacturing Photolithography Chemistry

  17. QUALITYCLIA and stringent QC labCaptured perfectly Per SNP algorithm checksPer SNP concordanceH-W equilibrium checks

  18. What we do Review world class academic and clinical research published in leading peer-reviewed journals… …and provide personalized, preventative, health and wellness information 23 Navigenics CONFIDENTIAL Navigenics CONFIDENTIAL

  19. Stringent Curation Criteria • Replication in the same ethnic group • Once for GWAS, twice for candidate gene studies • >60% independent sample sets show same statistically significant effect with same allele (after trimming underpowered samples) • Study design - An effort was made to sample controls from the same source population as the cases, e.g. ethnicity, gender, age, or other risk factors. • Reasonable sample size to detect weak effects. OR <1.5 needs 250 cases/250 controls at least. • Significance level - Exact value depends on magnitude of the study (e.g. GWAS or candidate gene) • Sound statistical design - correction for multiple testing, population stratification, confounding • Sound laboratory practice - independent genotyping platforms, replicated samples • Functional data and magnitude of effect are also taken into account, but studies are not automatically excluded if functional data is unavailable or the effect estimate is small.

  20. Finding the Relative Risk - see full details at navigenics.com Genotype Freq ? OR (RR)  (RN) ? OR (RN)  (RN) Prevalence • We normally get genotypic odds ratios RR/NN, RN/NN • Using genotype frequencies and prevalence, we derive a set ofquadratic equations – the solution provides the relative risks.

  21. Distribution of effect sizes for genetic and environmental risk factors Risk factors determined from literature using strict curation guidelines

  22. Google, Microsoft, MDVIP, Cisco, etc…

  23. Distribution of fold change in lifetime risk by individual patient Orange (>1.2X) Gray (<1.2X) Average lifetime risk for this condition = 0.06% Individual’s estimated lifetime risk = 0.37% Fold change in ALTR= 0.37/0.06 = 6.2 • Across the entire population: • 98% of patients showed at least condition with >1.2X increase in average lifetime risk • 45% of patients showed at least condition with >3X increase in average lifetime risk Fold ALTR Individual Patient Number

  24. Conditions with >3X ALTR risk by individual patient Fold ALTR Individual Patient Number Alzheimer’s disease Celiac disease Crohn’s disease Glaucoma Grave’s disease Macular degeneration Multiple sclerosis

  25. Alzheimer’s Disease: Homozygous or Orange 30% APOE4 Heterozygous 3.3% APOE4 Homozygous

  26. Clinical Decision Support - Prevention

  27. GUIDE PATIENTS TO PRIMARY PREVENTION TRIALS

  28. fMRI in at-risk Individuals as a Surrogate for Clinical Efficacy (BAI) • “push” loaded patients to BAI via Navigenics • baseline imaging performed • patients go on drug and placebo • periodic functional imaging • use imaging as surrogate measure of clinical efficacy • PROS: • hundreds of patients vs. thousands • years vs. decades • millions vs. hundreds of millions • within patent life of compound • CONS: • imagining not endpoint for approval • no biomarker associated with imaging

  29. Deliver genome and CDS via HIT

  30. Health Information Technology Accelerates Personalized Medicine Embed the genome into the electronic medical record (EMR) Role-based access to genome data (insurance companies excluded) Connect to a consumer-facing portal (PCHR, patientslikeme, Healthvault) Allow HIPAA-compliant messaging and interventional distributed trials Secure and authenticate transactions and data flow Undergird the clinical information system with a research database that can connect to other regional HIT systems (MS Amalga) Build a flexible clinical decision support module that allows physicians to understand molecularly-guided strategies Enable a “learning” CDS that constantly refines itself with the data flows to optimize clinical care 36

  31. Summary of Solution – Alzheimer’s • Identify genes that classify the population into “high” and “low” risk • Build a broad-based CLIA genetic testing infrastructure to classify individuals across the world (Navigenics) • Incorporate pointers to push “high” risk individuals into our clinical trial at BAI • Develop functional brain imaging strategy that can detect the earliest brain changes associated with AD that can be used as a surrogate measure of clinical efficacy in slowing AD pathology • Run a series of small trials drawing on a national base and fMRI to develop primary prevention drugs for AD in the next decade • Work with the FDA so that fMRI and associated biomarkers are robust enough for approval of primary prevention therapies • Use HIT vehicle to disseminate approved therapies back to population 37

  32. Results of Personalized Medicine in Chronic Disease Genomic Profile / Predisposition / Environmental Risks Family Members’ Health Care Personal Health / Wellness (Disease pre-emption) Interaction with Health Care Provider (Early diagnosis if needed) Learning Health Care System Interventions (Targeted treatment individualized to my molecular profile and that of my disease) Post-Disease Management 38

  33. What Does Success Look Like? $ $ Americans living longer without disease American health care delivering value at reduced cost “Connected” information from bench to bedside Robust pipeline of diagnostics and targeted therapeutics moving toward approval Growing portfolio of emerging, innovative companies 39

  34. TRANSFORMING THE HEALTH CARE SYSTEM THROUGH APPLIED RESEARCH IN THE NATIONAL CAPITAL AREAInova Health SystemGeorge Mason UniversityGeorge Washington University

More Related