What we have studied so far!

1. What we have studied so far! Biology 1 Quarter 2 • Microscopy • The plant and animal cell • Cell Organelles • GATTACA (What’s so “geek” about the title?) • March of the Penguins • STIs • Birth Control Methods

2. Now…a new topic and one of my favorites! DNA Stands for: • DEOXYRIBONUCLEIC ACID Topics: • Human Genome Project • Diagnosis and correction of genetic diseases • Genetic Engineering • DNA Fingerprinting • Current Research The Double Helix

3. Where is DNA located? If you made a little hole in the nucleus sack, you would see DNA peeking through. If you took away the outside of the nucleus (another membrane), the DNA would spill out like spaghetti. Stretched out, the DNA from one cell would be as long as the height of a tall man.

4. DNA coils to form a chromosome • Do you know chromosomes? • How many are in human body cells? • How many are in human sex cells? • Do you know Mitosis and Meiosis?

5. Structure • DNA is a “double helix” or twisted ladder • DNA would stretch 6 feet long • A four-letter language • A (adenine) with T (thymine) • C (cytosine) with G (guanine) • 3 billion letters make up the DNA in the human genome (all of DNA in the body cells)

6. What is DNA made up of? Nucleotide • Nitrogen Base (N-Base) A, T, C and G • Phosphate Group • Deoxyribose Sugar

8. The Base Pair Rule • Adenine always pairs with Thymine • A-T • Cytosine always pairs with Guanine • C-G

9. DNA • If you know one strand of DNA…what does the other read? 3’ATCGCGCTTAGCTACTGA5’ Strand 1 5’ 3’ Strand 2

10. STOP HERE

11. Central Dogma

12. DNA Double-Stranded A, C, G, and T Located in the nucleus DNA vs. RNA

13. DNA to RNA to Protein • DNA (the blueprint) to make RNA (builders) to make Proteins (hair, skin, eye color) Memorize this:

15. RNA to Protein(also known as Translation) • Once RNA is made it carries the instructions from the DNA to make a protein to the ribosome. • Proteins are made of amino acids (there are 20) and we get them from the food we eat.

17. Translation • An RNA code is 3 letters for each amino acid. 3 letters = 1 Codon • See table 11.2 p. 298 (Blue Book) • What is the amino acid sequence of this protein? • How many codons? UAGUUAUCGCGGAGCAGAAAGGGGGUGUAG

18. Mistakes in DNA or RNA sequence • Mutations • Insertions ABCDE>AABCDE • Deletions ABCDE>ACDE • Inversions ABCDE>ABDCE • Result in: • Sickle Cell (A vs. T) • Huntington’s Disease • Cystic Fibrosis

19. Common Proteins • Collagen in the skin (connective tissue) • Cartilage in nose, ears, joints • Hemoglobin in blood • Blood Type (cell surface proteins) • Keratin in nails, hoofs, claws • Antibodies in the immune system • Myosin and Actin in muscles • Hormones like insulin, testosterone, estrogen • Lactase with breaks down milk (lactose intolerance)

20. STOP End of Part II

21. The Human Genome Project • The human genome is the “book of life” • DNA is the script for life • We are 99.9% identical • Identical twins have exactly the same DNA • We have the same sets of genes as other mammals (insulin, estrogen, testosterone, keratin, collagen)

22. HGP (continued) • The DNA code is 3 billion letters long in each cell of your body • AGC and T • 1985 first proposed to sequence the entire human genome • We can read the letters but we still need to make sense of it • Any scientist can use this information for their project

23. WHY? • Cure diseases • Sickle Cell, Cystic Fibrosis, Huntington’s disease, etc • We are all flawed at the DNA level • Ethics, using genetic information for ill practice