Goal 3.01b: Protein Synthesis and Gene Regulation

1. Goal 3.01b: Protein Synthesis and Gene Regulation Genetics: A whole new spin on “who’s who.”

2. Central Dogma From Gene to Protein

3. Bodies  Cells  DNA • Bodies are made up of cells • All cells run on a set of instructions spelled out in DNA

4. What makes it possible for different people… neveryetmelted.com …to be different heights? i.ivillage.com www.learnwell.org … to have different faces? www.saidaonline.com …to have different colored eyes? symonsez.files.wordpress.com

5. Those proteins give us our looks. Makes this protein… Each DNA makes a specific protein. or this protein… gamespot.com or this protein! cr4.globalspec.com

6. Remember… • Bases match together • A pairs with T • A : T • C pairs with G • C : G • weak bonds between bases join 2 strands • can separate easily Now it is time to find out how DNA manages to create so many different kinds of organisms using only FIVEpieces of information!

7. What do we know? • DNA • DNA is the genetic information • Proteins • proteins run living organisms • enzymes • all chemical reactions in living organisms are controlled by enzymes (proteins) • structure • all living organisms are built out of proteins • DNA is the instructions for making proteins

8. What else do we know? • DNA • DNA is in the nucleus • want to keep it there = protected • Proteins • made by a “protein factory” in cytoplasm • ribosomes • Need to get gene (DNA) information from nucleus to cytoplasm • need a messenger! • need a copy of DNA • mRNA

9. deoxyribose sugar nitrogen bases G, C, A, T T = thymine T : A C : G double stranded ribose sugar nitrogen bases G, C, A, U U = uracil U : A C : G single stranded RNA DNA

10. A brief overview of what happens… transcription protein DNA mRNA translation trait nucleus cytoplasm

11. The problem with DNA… TOO BIG! DNA (double helix) is too big to go through the pores in the nuclear envelope. Just right. RNA (single helix) is small. DNA gives its information to mRNA (messenger RNA) to carry out of the nucleus.

12. Making mRNA from DNA DNA strand is the template (pattern) match bases U : A G : C Enzyme RNA polymerase TRANSCRIPTION mRNA

13. Making mRNA from DNA TRANSCRIPTION T G G T A C A G C T A G T C A T C G T A C C G T U U U U U T G G T A C A G C T A G T C A T C G T A C C G T

14. Double stranded DNA unzips TRANSCRIPTION T G G T A C A G C T A G T C A T C G T A C C G T

15. Use RNA polymerase Match free floating RNA bases to DNA bases on one of the DNA strands RNA polymerase TRANSCRIPTION Free-floating nucleotides A C U G A G G U C U U G C A C A U A G A C U A G C C A T G G T A C A G C T A G T C A T C G T A C C G T

16. TRANSCRIPTION We are transcribing DNA into RNA. U instead of T is matched to A DNA mRNA Transcription Animation http://www.stolaf.edu/people/giannini/flashanimat/molgenetics/transcription.swf

17. aa aa aa aa A C C A U G U C G A U C A G U A G C A U G G C A aa aa aa What do we know NOW? • DNA • instructions remain in nucleus • mRNA • has the instructions for building proteins from DNA • Proteins • built as chains of amino acids • What reads RNA? • need a mRNA reader! • rRNA in ribosomes

18. From gene to protein ribosome rRNA A C C A U G U C G A U C A G U A G C A U G G C A CELL cytoplasm Protein Trait aa aa Transcription aa DNA aa Translation aa mRNA aa aa nucleus mRNA leaves nucleus through nuclear pores rRNA inside the ribosomes synthesize amino acids to make a protein using instructions on mRNA

19. aa ribosome aa a a A C C A U G U C G A U C A G U A G C A U G G C A aa aa aa What do we ALSO know now? • mRNA • has the instructions for building proteins from DNA • Proteins • built as chains of amino acids linked by peptide bonds • What reads mRNA? • ribosome • What brings the right amino acid to attach to the protein chain? • need an amino acid transporter! • tRNA Peptide bonds

20. From gene to protein ribosome A C C A U G U C G A U C A G U A G C A U G G C A CELL cytoplasm Protein Trait aa aa Transcription aa DNA aa Translation aa mRNA aa nucleus tRNA tRNA carries the correct amino acid (based on the mRNAcode) to the ribosome. aa

21. Let’s build a flow chart! Protein Synthesis TRANSCRIPTIONDNA gives mRNA blueprints for making a specific protein. mRNA carries the blueprints out of the nucleus to the cytoplasm and finds a ribosome. TRANSLATIONrRNA reads the mRNA inside the ribosome.

22. tRNA brings the correct amino acid to the mRNA. An amino acid chain is built: PROTEIN. Protein give us our traits. BUILD DNA AND DISCOVER GENES!http://learn.genetics.utah.edu/content/begin/dna/ 1. What is DNA?2. What is a Gene?3. Build a DNA Molecule.

23. How does tRNA know which amino acid to bring? When mRNA leaves nucleus it has a blueprint of DNA’s instructions. mRNA goes to ribosomes in cytoplasm Ribosomes read the blueprint on mRNA. ribosome mRNA A C C A U G U C G A U C A G U A G C A U G G C A aa aa aa aa aa aa aa aa

24. TACGCACATTTACGTACGCGG DNA MetArgValAsnAlaCysAla protein ? Using the template… How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? AUGCGUGUAAAUGCAUGCGCC mRNA

25. mRNA codes for proteins in triplets ribosome TACGCACATTTACGTACGCGG DNA Aminoacid MetArgValAsnAlaCysAla ? Codon = set of 3 bases AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC UAC Anticodon = set of 3 bases

26. The code is UNIVERSAL! AUG • Since all living organisms… • use the same DNA • use the same code book • read their genes the same way

27. What amino acids are coded for by these codons? UGA ACU AAC GAG

28. For ALL life! Uses only 4 bases for ALL life. (strongest support for a common origin for all life) Code is redundant several codons for each amino acid mutation insurance! The mRNA code • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

29. TACGCACATTTACGTACGCGG AUGCGUGUAAAUGCAUGCGCC mRNA DNA Transcription and Translation Builder http://learn.genetics.utah.edu/content/begin/dna/transcribe/ Ala Met Arg Arg Pro Met tRNA tRNA tRNA tRNA Val Leu

30. Transcription in Real Time (view as class) http://www.dnalc.org/resources/3d/TranscriptionBasic_withFX.htmll Step Through Translationhttp://bcs.whfreeman.com/thelifewire/content/chp12/1202003.html You Transcribe and Translate a Gene!http://learn.genetics.utah.edu/content/begin/dna/ 1. Transcribe and Translate a Gene2. What makes a firefly glow? DNA Translation Real Time and Interactive http://www.dnai.org/a/index.html

31. A Quick Review…. DNA 1. What is this molecule? transcription 3.What is this process? 6.What are these molecules? aminoacids mRNA 2.What is this molecule? Can you tell the story? 5.What is this molecule? protein ribosome 4.What is this structure? tRNA 7.What is this molecule? translation 8.What is this process? 29:08 Central Dogma Biologix__Translation_and_Protein_Synthesis

32. Substitution/Point Mutation = one base is changed and one amino acid is changed. DNA TAC GCA TGG AAT  TAC GCA TGG AAT T mRNA AUG CGU ACC UUA  AUG CAU ACC UUA Protein Met Arg Thr Leu  Met His Thr Leu Insertion Mutation = one base is inserted and everything downstream is changed. DNA TAC GCA TGG AAT  TAC GTA TGG AAT DNA TAC GCA TGG AAT  TAT CGT ATG GAA T mRNA AUG CGU ACC UUA  AUA GCA UAC CUU A Protein Met Arg Thr Leu  Ile Ala Tyr Leu http://highered.mcgraw-hill.com/sites/0072556781/student_view0/chapter11/animation_quiz_4.html

33. EXPLAIN DIVERSITY… • Each organism has a unique sequence of DNA. • The DNA sequence determines the order of amino acids in the organism’s proteins. • The order of amino acids determines the shape that the protein made will take. • The shape of the protein determines what it can do. • What the protein does determines everything about the organism. • Gene Regulation determines when a sequence of DNA will be put to use and when it won’t.

34. Gene Regulation…Keeping Control! Every species has its own number of chromosomes in each cell. Notice: More is not always better... Sometimes it’s just more.

35. Remember…a section on a chromosome that codes for a specific trait is called a GENE. And… There are lots and lots of genes on each chromosome! The job of a gene is to control the production of proteins.

36. Not every gene is expressed (turned on) at the same time. Gene Regulation = what controls when a gene is expressed and when it is not. In bacteria, genes are in groups called Operons. Example: E. coli that’s in our digestive system helps us break down milk. Each Operon codes for a specific protein. Baby features (birth – 5 yrs) Teen features (12 yrs – 17 yrs) Adult features (17 yrs – 60 yrs) Child features (5 yrs – 12 yrs) Elderly features (60 yrs – death)

37. Start Codon = set of three nucleotide bases where transcription begins. Stop Codon = set of three nucleotide bases where transcription ends. RNA polymerase 3’ Gene 5’ Promoter Sequence = area “upstream” (toward the 5’ end) from the gene where the RNA polymerase attaches. Terminator Sequence = area “downstream” from the gene where the polymerase detaches.

38. Has to have a CAP to start. Are You Lactose Intolerant? Here’s how we metabolize milk… Can NOT have a Repressor. Lac operon http://sumanasinc.com/webcontent/animations/content/lacoperon.html

39. Beadle and Tatum One gene, one protein. Beadle and Tatum Experiment http://wps.prenhall.com/wps/media/objects/1552/1589869/web_tut/21_04/21_04_01a.swf

40. Gene Therapy: Introduction What is Gene Therapy? Using parts of a gene from a healthy cell to fix a damaged or sick cell. How Gene Therapy Works (Interactive)http://www.edu365.cat/aulanet/comsoc/Lab_bio/simulacions/GeneTherapy/GeneTherapy.htm

41. Don’t hate me because I’m beautiful… Blame it on my GENES! Any Questions? Assignment: Coach Book L15 img1.chakpak.com