Topic: DNA Date: February 8, 2013

Topic: DNA Date: February 8, 2013 DNA structure and function and replication

Objective SWBAT-Explain the key structural features of DNA as well as DNA’s function. -Explain the key steps of DNA replication

Warm up From yesterday’s lesson, 1. What are two things you learned about DNA’s structure? 2. What’s one thing that you found interesting?

The Structure andFunction of DNA

Instead it’s in the Nucleoid Prokaryotic cells lack a true nucleus Example: bacteria and archaea Eukaryotic cells have a nucleus surrounded by a nuclear membrane Examples: ALL cells except bacteria and Archaea These areas contain DNA

I. DNA stands for DeoxyriboNucleic Acid a. Deoxyribose= sugar b. Nucleic = located in the nucleus or nucleoid (free floating in prokaryotes) c. Acid= acidic in nature 2. DNA is… a. found in the nucleus of the cell b. the genetic material in each cell c. the chemical that processes and determines which proteins will be made by the cell.

3. DNA is made up of nucleotides • 5 Carbon sugar called deoxyribose • Phosphate group • One of 4 nitrogen bases • Adenine=A • Thymine=T • Cytosine=C • Guanine=G Many, many nucleotides make up a single DNA molecule

Types of Bases • Purine-have two rings of carbon and nitrogen atoms • Adenine • Guanine • Pyrimidine-have one ring of carbon and nitrogen atoms • Cytosine • Thymine

*Nucleotides are connected by attachment of the deoxyribose and the phosphates

4. DNA is in the form of a double helix a. The sides of the helix/ladder are the alternating phosphate groups and deoxyribose sugars b. The rungs are paired nitrogen bases *Only certain nitrogen bases can pair up with each other: Adenine pairs with thymine Cytosine pairs with guanine

C. The base pairs of the rungs (A-T& C-G) are held together by hydrogen bonds that are easily broken.

Hydrogen bond Label: Deoxyribose Phosphate cytosine nucleotide guanine thymine adenine

Write the letters for the matching nucleotides on the strand of DNA. *Remember, Adenine always pairs with Thymine. Cytosine always pairs with Guanine. ATTATACGTAGCTAGCTGATCGATCG TAATATGCATCGATCGACTAGCTAGC

The Functions of DNA

1. DNA contains the genetic message (Morse Code) to be passed on to the next generation. 2. DNA is the template for RNA which is the template for proteins that determine a living organism’s traits. 3. DNA must replicate (for mitosis and meiosis)

A segment of DNA that codes for a specific trait is called a gene. This is Gene.

The players • Helicase-separate nucleic acid strands • DNA PolymeraseI-can add new nucleotides to the 3’ end of DNA, also replaces RNA primer with DNA in lagging strand • DNA Ligase-repairs single strand discontinuities • RNA Primase-an enzyme that synthesizes short RNA sequences called primers. These primers serve as a starting point for DNA synthesis by adding a 3’ starting point. • DNA Polymerase III-adds nucleotide from RNA primer to RNA primer (from the 3’ added by the RNA primase to the next primer)

DNA replication: • Before a cell can divide, the DNA • must replicate. • The hydrogen bonds holding the • bases together are broken by Helicase (DNA is now single stranded.) • 2. DNA polymerase III (an enzyme) • attaches the complementary base • pairs to the leading strand

On the lagging strand, DNA primase adds short RNA primers that provide a 3’ end • DNA Polymerase III adds nucleotides from the 3’ end of the RNA primer towards the next primer • DNA Polymerase I replaces DNA Polymerase III, and replaces the RNA primers with DNA nucleotides • Gaps between the 3’ and 5’ends of nucleotides are sealed by ligase

DNA Animation • ://highered.mcgrawhill.com/olcweb/cgi/pluginpop.cgi?it=swf::535::535::/sites/dl/free/0072437316/120076/micro04.swf::DNA%20Replication%20Fork.swf

Original DNA This is called semi-conservative Replication. New DNA

1. 3. 2. • *DNA “unzips” • New bases attached with help of • DNA polymerase. Original DNA Two Identical strands

Replicate this DNA strand: C A T C A T C A T T A G T A G G T A G T A G T A A T C A T C

Topic: DNA Date: February 8, 2013