1 / 54

From Gene to Protein

From Gene to Protein. How Genes Work. Tour of the Cell. Let’s begin by reviewing the organelles involved in protein synthesis. Making proteins. Organelles nucleus ribosomes endoplasmic reticulum (ER) Golgi apparatus vesicles. small ribosomal subunit. nuclear pore. mRNA. large

rosina
Télécharger la présentation

From Gene to Protein

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. From Gene to Protein How Genes Work

  2. Tour of the Cell • Let’s begin by reviewing the organelles involved in protein synthesis.

  3. Making proteins • Organelles • nucleus • ribosomes • endoplasmic reticulum (ER) • Golgi apparatus • vesicles small ribosomal subunit nuclear pore mRNA large ribosomal subunit cytoplasm

  4. Nucleus & Nucleolus

  5. large subunit small subunit ribosome Nucleolus • Function • ribosome production • build ribosome subunits from rRNA & proteins • exit through nuclear pores to cytoplasm & combine to form functional ribosomes rRNA & proteins nucleolus

  6. large subunit small subunit 0.08mm Ribosomes Rough ER Smooth ER Ribosomes • Function • protein production • Structure • rRNA & protein • 2 subunits combine

  7. Types of Ribosomes • Freeribosomes • suspended in cytosol • synthesize proteins that function in cytosol • Bound ribosomes • attached to endoplasmic reticulum • synthesize proteins for export or for membranes membrane proteins

  8. TO: TO: TO: TO: endoplasmicreticulum nucleus proteinon its way! DNA RNA vesicle vesicle ribosomes TO: protein finishedprotein Golgi apparatus Making Proteins

  9. The Protein Assembly Line Golgiapparatus ribosome ER Building Proteins • Organelles involved • nucleus • ribosomes • endoplasmic reticulum (ER) • Golgi apparatus • vesicles nucleus vesicles

  10. End of the Tour

  11. TACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTATACGCACATTTACGTACGCGGATGCCGCGACTATGATCACATAGACATGCTGTCAGCTCTAGTAGACTAGCTGACTCGACTAGCATGATCGATCAGCTACATGCTAGCACACYCGTACATCGATCCTGACATCGACCTGCTCGTACATGCTACTAGCTACTGACTCATGATCCAGATCACTGAAACCCTAGATCGGGTACCTATTACAGTACGATCATCCGATCAGATCATGCTAGTACATCGATCGATACTGCTACTGATCTAGCTCAATCAAACTCTTTTTGCATCATGATACTAGACTAGCTGACTGATCATGACTCTGATCCCGTA

  12. A B C D E disease disease disease disease Metabolism taught us about genes • Inheritance of metabolic diseases • suggested that genes coded for enzymes • each disease (phenotype) is caused by non-functional gene product • lack of an enzyme • Tay sachs • PKU (phenylketonuria) • albinism metabolic pathway     enzyme 1 enzyme 2 enzyme 3 enzyme 4

  13. PKUphenylketonuria alkaptonuria tyrosinosis albinism cretinism ingested protein digestion phenylalanine phenylalanine hydroxylase melanin tyrosine thyroxine transaminase hydroxyphenylpyruvicacid hydroxyphenylpyruvic acidoxidase homogentisicacid homogentisic acidoxidase maleylacetoaceticacid CO2 & H2O

  14. 1941 | 1958 Beadle & Tatum one gene : one enzyme hypothesis George Beadle Edward Tatum "for their discovery that genes act by regulating definite chemical events"

  15. One gene / one enzyme hypothesis • Damage to specific gene, mapped to nutritional mutations gene cluster 1 gene cluster 2 gene cluster 3 chromosome arg-E arg-H arg-G arg-F encoded enzyme enzyme E enzyme F enzyme G enzyme H glutamate ornithine citruline arginine argino- succinate gene thatwas damaged substrate in biochemical pathway

  16. The “Central Dogma” • Flow of genetic information in a cell • How do we move information from DNA to proteins? transcription translation RNA DNA protein trait replication

  17. RNA • ribose sugar • N-bases • uracil instead of thymine • U : A • C : G • single stranded • lots of RNAs • mRNA, tRNA, rRNA transcription DNA RNA

  18. From nucleus to cytoplasm… • Where are the genes? • genes are on chromosomes in nucleus • Where are proteins synthesized? • proteins made in cytoplasm by ribosomes • How does the information get from DNA in nucleus to cytoplasm? • messenger RNA nucleus

  19. Transcription fromDNA languagetoRNA language

  20. Transcription • Making mRNA • transcribed DNA strand = template strand • untranscribed DNA strand = coding strand • same sequence as RNA • synthesis of complementary RNA strand • transcription bubble • enzyme • RNA polymerase coding strand 3 A G C A T C G T 5 A G A A A C G T T T T C A T C G A C T DNA 3 C T G A A 5 T G G C A U C G U T C unwinding 3 G T A G C A rewinding mRNA template strand RNA polymerase 5 build RNA 53

  21. Bacterial chromosome Transcription in Prokaryotes Transcription mRNA Psssst…no nucleus! Cell membrane Cell wall

  22. Transcription in Prokaryotes • Initiation • RNA polymerase binds to promoter sequence on DNA Role of promoter • Starting point • where to start reading • start of gene • Template strand • which strand to read • Direction on DNA • always read DNA 35 • build RNA 53

  23. Transcription in Prokaryotes • Elongation • RNA polymerase copies DNA as it unwinds • ~20 base pairs at a time • 300-500 bases in gene • builds RNA 53 • Simple proofreading • 1 error/105 bases • make many mRNAs • mRNA has short life • not worth editing! reads DNA 35

  24. Transcription in Prokaryotes • Termination • RNA polymerase stops at termination sequence RNA GC hairpin turn

  25. Transcription in Eukaryotes Transcription RNA Processing Psssst…DNA can’tleave nucleus! Translation Protein

  26. Prokaryotes DNA in cytoplasm circular chromosome naked DNA no introns Eukaryotes DNA in nucleus linear chromosomes DNA wound on histone proteins introns vs. exons intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Prokaryote vs. Eukaryote genes eukaryotic DNA

  27. Transcription in Eukaryotes • 3 RNA polymerase enzymes • RNA polymerase 1 • only transcribes rRNA genes • makes ribosomes • RNA polymerase 2 • transcribes genes into mRNA • RNA polymerase 3 • only transcribes tRNA genes • each has a specific promoter sequence it recognizes

  28. Transcription in Eukaryotes • Initiation complex • transcription factors bind to promoter region upstream of gene • suite of proteins which bind to DNA • turn on or off transcription • TATA box binding site • recognition site for transcription factors • transcription factors trigger the binding of RNA polymerase to DNA

  29. intron = noncoding (inbetween) sequence exon = coding (expressed) sequence Post-transcriptional processing • Primary transcript (pre-mRNA) • eukaryotic mRNA needs work after transcription • mRNA processing (making mature mRNA) • mRNA splicing = edit out introns • protect mRNA from enzymes in cytoplasm • add 5 cap • add polyA tail 3' poly-A tail 3' A A A A A mRNA 50-250 A’s 5' cap P P P 5' G ~10,000 bases eukaryotic DNA pre-mRNA primary mRNA transcript ~1,000 bases mature mRNA transcript spliced mRNA

  30. Protecting mRNA • 5’ cap added • G trinucleoside (G-P-P-P) • protects mRNA • from RNase (hydrolytic enzymes) • 3’ poly-A tail added • 50-250 A’s • protects mRNA • from RNase (hydrolytic enzymes) UTR UTR

  31. Splicing mRNA: Introns vs. Exons • Pre-mRNA  mRNA • edit out introns • intervening sequences • splice together exons • expressed sequences • In higher eukaryotes • 90% or more of gene can be intron

  32. Splicing enzymes • snRNPs • small nuclear RNA • RNA + proteins • Spliceosome • several snRNPs • recognize splice site sequence • cut & paste • RNA as ribozyme • some mRNA can splice itself • RNA as enzyme

  33. Alternative splicing • Alternative mRNAs produced from same gene • when is an intron not an intron… • different segments treated as exons

  34. Translation fromnucleic acid languagetoamino acid language

  35. Bacterial chromosome Translation in Prokaryotes Transcription mRNA Translation Psssst…no nucleus! protein Cell membrane Cell wall

  36. Translation in Prokaryotes • Transcription & translation are simultaneous in bacteria • DNA is in cytoplasm • no mRNA editing • ribosomesread mRNA as it is being transcribed

  37. Translation: prokaryotes vs. eukaryotes • time & physical separation between processes - DNA is in cytoplasm in prokaryotes - Ribosomes read mRNA as it is being transcribed in prokaryotes RNA processing – No editing of mRNA in prokaryotic cells

  38. Translation in Eukaryotes

  39. aa aa ribosome aa aa aa aa aa aa From gene to protein transcription translation DNA mRNA protein mRNA leaves nucleus through nuclear pores proteins synthesized by ribosomes using instructions on mRNA nucleus cytoplasm

  40. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA MetArgValAsnAlaCysAla protein ? How does mRNA code for proteins? How can you code for 20 amino acids with only 4 nucleotide bases (A,U,G,C)? 4 ATCG 4 AUCG 20

  41. TACGCACATTTACGTACGCGG DNA AUGCGUGUAAAUGCAUGCGCC mRNA AUGCGUGUAAAUGCAUGCGCC mRNA codon MetArgValAsnAlaCysAla protein ? mRNA codes for proteins in triplets

  42. Translation • Codons • blocks of 3 nucleotides decoded into the sequence of amino acids

  43. The code • Code for ALL life! • strongest support for a common origin for all life • Code is redundant • several codons for each amino acid • Start codon • AUG • methionine • Stop codons • UGA, UAA, UAG

  44. GCA UAC CAU Met Arg Val How are the codons matched to amino acids? 3 5 TACGCACATTTACGTACGCGG DNA 5 3 AUGCGUGUAAAUGCAUGCGCC mRNA codon 3 5 tRNA aminoacid anti-codon

  45. aa aa ribosome aa aa aa aa aa aa From gene to protein transcription translation DNA mRNA protein nucleus cytoplasm

  46. Transfer RNA structure • “Clover leaf” structure • anticodon on “clover leaf” end • amino acid attached on 3 end

  47. Loading tRNA • Aminoacyl tRNA synthetase • enzyme which bonds amino acid to tRNA • energy stored in tRNA-amino acid bond • unstable • so it can release amino acid at ribosome easily Trp C=O Trp Trp C=O H2O OH O OH C=O O activating enzyme tRNATrp A C C mRNA U G G anticodon tryptophan attached to tRNATrp tRNATrp binds to UGG condon of mRNA

  48. Ribosomes • Facilitate coupling of tRNA anticodon to mRNA codon • Structure • ribosomal RNA (rRNA) & proteins • 2 subunits • large • small E P A

  49. Ribosomes • A site (aminoacyl-tRNA site) • holds tRNA carrying next amino acid to be added to chain • P site (peptidyl-tRNA site) • holds tRNA carrying growing polypeptide chain • E site (exit site) • empty tRNA leaves ribosome from exit site Met C A U 5' G U A 3' E P A

  50. 3 2 1 Building a polypeptide • Initiation • brings together mRNA, ribosome subunits, initiator tRNA • Elongation • adding amino acids based on codon sequence • Termination • end codon release factor Leu Val Ser Met Met Ala Leu Met Met Leu Leu Trp tRNA C A G C G A C C C A A G A G C U A C C A U A U U A U G A A 5' 5' A A 5' C U U 5' A A G G A G U U G U C U U U G C A C U 3' G G U A A U A A C C mRNA 3' 3' 3' U G G U A A 3' E P A

More Related