1 / 29

Application of Genetic Markers to Dairy Cattle

Application of Genetic Markers to Dairy Cattle. Overview. Traditional selection Genetic markers Granddaughter design Resource populations QTL identification EST sequencing. Introduction.

sashar
Télécharger la présentation

Application of Genetic Markers to Dairy Cattle

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Application of Genetic Markers to Dairy Cattle

  2. Overview • Traditional selection • Genetic markers • Granddaughter design • Resource populations • QTL identification • EST sequencing

  3. Introduction • Traditional dairy cattle breeding has assumed that an infinite number of genes each with very small effect control most traits of interest • Logical to expect some “major” genes with large effect; these genes are usually called quantitative trait loci (QTL) • The QTL locations are unknown! • Genetic markers can provide information about QTL

  4. Traditional Selection Programs • Estimate genetic merit for animals in a population • Select superior animals as parents of future generations

  5. Genetic Improvement: Challenges and Technologies Traditional selection Abundant Genetic variation Gene mapping and marker assisted selection Limited genetic variation Transgenics Little or no genetic variation

  6. Application of Genetic Markers • Identify genetic markers that are associated with changes in genetic merit • Use marker assisted selection (MAS) to make selection decisions before phenotypes are available • Adjust genetic merit for genetic markers

  7. Useful Genetic Markers: • Allow marker inheritance to be followed across generations • Many different types of marker alleles well represented in the population • Marker and QTL are close together so that recombination between marker and QTL is rare • Best case is when we know the QTL - then it is the marker!

  8. NAAB Dairy Trade Mission – Genetic Marker Evaluation (8) Curt Van Tassell 2002 Linkage Distance M Q m q { { Marker Locus Quantitative Trait Locus

  9. M Q m q M q m Q { { Marker Locus Quantitative Trait Locus NAAB Dairy Trade Mission – Genetic Marker Evaluation (9) Curt Van Tassell 2002 Parental Chromosomes Recombinant Chromosomes

  10. C D E F A B f c d e a b * * * * * * * NAAB Dairy Trade Mission – Genetic Marker Evaluation (10) Curt Van Tassell 2002 Parental Chromosomes Recombinant Chromosomes

  11. Genetic Markers NAAB Dairy Trade Mission – Genetic Marker Evaluation (11) Curt Van Tassell 2002

  12. Genetic Markers!! NAAB Dairy Trade Mission – Genetic Marker Evaluation (12) Curt Van Tassell 2002

  13. Genetic Markers NAAB Dairy Trade Mission – Genetic Marker Evaluation (13) Curt Van Tassell 2002

  14. Granddaughter Design NAAB Dairy Trade Mission – Genetic Marker Evaluation (14) Curt Van Tassell 2002 Bull

  15. Granddaughter Design NAAB Dairy Trade Mission – Genetic Marker Evaluation (15) Curt Van Tassell 2002 Sons

  16. Granddaughter Design NAAB Dairy Trade Mission – Genetic Marker Evaluation (16) Curt Van Tassell 2002

  17. Granddaughter Design DNA Genetic Merit Data NAAB Dairy Trade Mission – Genetic Marker Evaluation (17) Curt Van Tassell 2002

  18. Resource Populations:Cooperative Dairy DNA Repository (CDDR) • The CDDR is an ongoing collection of all bulls entering progeny tests • Includes all breeds • Useful for QTL mapping in dairy cattle using a granddaughter design and for complex pedigree analysis • Currently (6/01): • Six North American studs contributing semen • 9789 bulls in the collection • 128 families with at least 25 sons

  19. NAAB Dairy Trade Mission – Genetic Marker Evaluation (19) Curt Van Tassell 2002 QTL Identification Compare Genetic Merit

  20. NAAB Dairy Trade Mission – Genetic Marker Evaluation (20) Curt Van Tassell 2002 QTL Identification Bull 1.7 3.5 -0.1 0.7 -2.5 -6.2 Sons

  21. USDA-ARS Progress • Over 160 markers studied in over 1000 animals from 8 families • Evaluated all available traits: Conformation traits, M, F, P, SCS, PL, and calving ease • Genome-wide scan across all families was recently completed

  22. Marker Association Results

  23. Family 8 interval analysis results NAAB Dairy Trade Mission – Genetic Marker Evaluation (23) Curt Van Tassell 2002

  24. What is an EST? Tissue Biopsy mRNA isolation ATG mRNA TAA 5’ 3’ AAAAAAAAA RT-PCR 3’ 5’ AAAAAAAAA cDNA 5’ TTTTTTTTTT 3’ Sequencing of cDNA clones ESTs Bioinformatics Bovine Sequence database NAAB Dairy Trade Mission – Genetic Marker Evaluation (24) Curt Van Tassell 2002

  25. USDA-ARS Bovine EST Projects • Initial goal: Single pass sequencing of 5 bovine cDNA libraries • 4 axis libraries @ MARC = 80,000 EST • 1 mammary library @ BARC = 10,000 EST • Mammary cDNA library has stages from prepubertal, mid-gestation, late gestation, cholostrogenesis, lactation, infected lactation, and early and late involution. • Sample diverse developmental stages and morphological cell types to maximize diversity and minimize redundancy

  26. Status ARS EST sequencing GenBank dbEST database submissions: • 231,577 total cattle gene-related sequences • >150,000 cattle ESTs generated by USDA • 120,745 cattle sequences 1-4BOV cDNA libraries (MARC) • 23,202 cattle sequences 5BOV cDNA library (BARC)

  27. EST Sequence Analysis & Assembly AGCTTTAAGCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATACCTTAGGGTCAGCTTTAAGCCATACCTTAGGACATTACCTAGG NAAB Dairy Trade Mission – Genetic Marker Evaluation (27) Curt Van Tassell 2002 EST1 AGCTTTAAGCCATACCTTAGGACATTACCTAGG EST2 GCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATACCTTAGGGTC EST3 AGCTTTAAGCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATACCTTAGGGTCAGCTTTAAGCCATACCTTAGGAC EST4 AGCTTTAAGCCATACCTTAGGGTCAGCTTTAAGCCATACCTTAGGACATTACCTAGG TC TIGR Bovine Gene Index: Over 67,000 unique sequence elements

  28. Unique Cattle Sequences NAAB Dairy Trade Mission – Genetic Marker Evaluation (28) Curt Van Tassell 2002 Human Golden Path Human Gene Index 22,760 28,617 24,149 18,292 11,077 15,238 10,175 TOGA 31,671 36,734 2,542 Mouse Gene Index 44,367 Rat Gene Index Over 17,000 “no hit” bovine sequence elements.

  29. Conclusions • Marker assisted selection is an evolutionary improvement over traditional selection methods. It allows more accurate estimation genetic merit of animals • Evidence of important QTL has been found • EST sequencing has been very successful • Lots of interesting findings from EST project that will need additional research

More Related