1 / 75

Computational Biology of diabetes mellitus

Computational Biology of diabetes mellitus. Allam Appa Rao JNTU Kakinada Kakinada 533 003. IT in Health Care: New Trends and Technologies RMC, Kakinada 18 th April 2010. information. ‘In-formation’ is a word derived from a latin word ‘Informare’,

saxon
Télécharger la présentation

Computational Biology of diabetes mellitus

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Computational Biology of diabetes mellitus Allam Appa Rao JNTU Kakinada Kakinada 533 003 IT in Health Care: New Trends and Technologies RMC, Kakinada 18th April 2010 Allam Appa Rao

  2. information ‘In-formation’ is a word derived from a latin word ‘Informare’, which means to put it into from or in-formation. Another meaning is ‘to give form to the mind’ Allam Appa Rao

  3. Philosophy of Information Philosophy of information (PI) is the area of research that studies conceptual issues arising at the intersection of computer science, information technology, and philosophy Allam Appa Rao

  4. My interest My interest is the investigation of the conceptual nature and basic principles of information, includes its dynamics, utilisation and sciences & elaboration and application of information-theoretic and computational methodologies to problems Allam Appa Rao

  5. JNTU-K VISION “Attaining new heights in research by shaping IT as a premier precision tool for the welfare of the poor”.

  6. Richard Dawkins University of California, Berkeley & Oxford University If you want to understand life, don't think about vibrant, throbbing gels .. think about information technology (IT). Allam Appa Rao

  7. HGP Recent human genome breakthrough is the result from the work of multi-disciplinary teams where cooperation from computer experts was a fundamental ingredient. Allam Appa Rao

  8. Cells as Information Systems Cells and cellular systems require viewing them as information processing systems, as evidenced by the fundamental similarity between molecular machines of the living cell and computational automata, and by the natural fit between computer process algebras and biological signaling and between computational logical circuits and regulatory systems in the cell AllamAppaRao

  9. Our Research Our research work is influenced by our fascination about the mysteries that remain in the catalogue of human genes. I believe that a systematic approach to the acquisition, management, and analysis of information available in human genes and their study can greatly enhance the quality and efficiency of medicines Allam Appa Rao

  10. Socrates taught us, the essence of Scienceis measuring, counting, and weighing together with reasoning from postulates or axioms Dijkstra "Computer Science is no more about computers than astronomy is about telescopes http://www.quotationspage.com/quote/788.html” Knuth “Science is what we understand well enough to explain to a computer” If you want to understand life, don't think about vibrant, throbbing gels and oozes, think about information technology. --- Richard Dawkins, University of California, BerkeleyOxford UniversityThe Blind Watchmaker, 1986, Norton, p. 112. Allam Appa Rao

  11. The Value of the Right Tool A “Supercomputer” Cluster 3.2 Billion Nucleotides

  12. Paradigm of 'computational thinking' Advances in computational power and computational methods have led to the crystallization of the paradigm of 'computational thinking’ Allam Appa Rao

  13. Paradigm of 'computational thinking‘ …… This paradigm of 'computational thinking‘ takes applications of computer science far beyond mere programming and data management. Allam Appa Rao

  14. Paradigm of 'computational thinking‘ …… • This paradigm of 'computational thinking’ provides newer methods for understanding the complex life style diseases like Diabetes. Allam Appa Rao

  15. http://www.ygyh.org/index.htm Allam Appa Rao

  16. IT Information technology (IT) is "the study, design, development, implementation, support or management of computer-based information systems, particularly software applications and computer hardware", according to the Information Technology Association of America (ITAA) IT deals with the use of electronic computers and computer software to convert, store, protect, process, transmit, and securelyretrieveinformation. Allam Appa Rao

  17. IT….. Information technology is a general term that describes any technology that helps to produce, manipulate, store, communicate, and/or disseminate information. Allam Appa Rao

  18. IT Over the past few decades rapid developments in molecular research technologies (MRT) and developments in information technologies (IT) have combined to produce a tremendous amount of information Allam Appa Rao

  19. Watson & Crick Raising their glasses in the Eagle, a pub near the campus of Cambridge University in England, a euphoric Francis Crick, 36, and James Waston, 24, drank to what they had just accomplished. Over the hubbub in the crowded pub. Crick’s voice boomed out, “We have discovered the secret of life!” Allam Appa Rao

  20. Anything Computable! • Markov defined what became known as Markov algorithms (HMM) for chemical computation • Alonzo Church used Lambda calculus for computing • Kurt Gödel defined Recursive functions Allam Appa Rao

  21. Information Theory, Evolution, and the Origin of Life Hubert P. Yockey, pp 35 Allam Appa Rao

  22. Computational Biology: Definition http://en.wikipedia.org/w/index.php?title=Computational_biology&oldid=128766842 Computational biology is a field that applies the techniques of computer science to address problems of biology. Allam Appa Rao

  23. Bioinformatics Allam Appa Rao

  24. Bioinformatics: Definition Bioinformatics is the application of information technology and computer science to the field of molecular biology. The term bioinformatics was coined by Paulien Hogeweg in 1979 for the study of informatic processes in biotic systems. Allam Appa Rao

  25. Bioinformatics: Entailment Bioinformatics entails the creation and advancement of databases, algorithms, computational and statistical techniques, and theory to solve formal and practical problems arising from the management and analysis of biological data. Allam Appa Rao

  26. Bioinformatics: Activities Common activities in bioinformatics include mapping and analyzing DNA and protein sequences, aligning different DNA and protein sequences to compare them and creating and viewing 3-D models of protein structures. Allam Appa Rao

  27. Bioinformatics: Research Major research efforts in the field include sequence alignment, gene finding, genome assembly, protein structure alignment, protein structure prediction, prediction of gene expression and protein-protein interactions, genome-wide association studies and the modelling of evolution. Allam Appa Rao

  28. Bioinformatics: Applications Bioinformatics focuses on developing and applying computationally intensive techniques like pattern recognition, data mining, machine learning algorithms, and visualization Allam Appa Rao

  29. DM: Definition Diabetes Mellitus is a condition in which the body either does not produce enough, or does not properly respond to, insulin, a hormone produced in the pancreas. Allam Appa Rao

  30. DM: Epidemic Diabetes Mellitus (DM) affects about 10-15% of the Indians and is assuming epidemic proportions, development of newer robust therapeutic approaches both in its prevention and treatment are needed. Allam Appa Rao

  31. Possible Future Treatment for Diabeteshttp://www.nature.com/nature/journal/vaop/ncurrent/pdf/nature08894.pdf • Insulin, a hormone produced by the pancreas, signals cells to remove glucose from the blood and store it as glycogen. Glucagon is a protein also produced by cells in the pancreas but it has the opposite effect of insulin. When blood glucose levels are low, glucagon causes the breakdown of glycogen into glucose that is then released into the blood. The insulin is made in beta cells, where as the glucagon is made in alpha cells. In patients with type 1 diabetes, the immune system attacks the beta cells, eliminating insulin production. Allam Appa Rao

  32. Possible Future Treatment for Diabetes.... Scientists from the University of Geneva have shown that alpha cells in the pancreas of mice have changed to insulin producing beta cells. In the study, approximately 5 % of the alpha cells became beta cells. The response seen only occurs in mice when the majority of the beta cells have been eliminated. Allam Appa Rao

  33. Possible Future Treatment for Diabetes..... If we can find a way to encourage human cells to transform in a similar way while preventing the immune system from destroying the new cells, even a small percentage of new beta cells could make a huge difference in the life of a diabetic. Identification of the mechanisms that transform alpha cells into beta cells will not only help in the treatment of diabetes but can reveal insights into the ability to direct changes in other cells, including cancer. Allam Appa Rao

  34. Our Work: BDNF • BDNF is a natural compound that is present in human body and hence therapeutics developed using these molecules are expected to have fewer side effects. • BDNF can indeed prevent and ameliorate DM, it would pave way to develop newer therapeutic opportunities. • BDNF as a therapeutic tool for the prevention and treatment of DM. Allam Appa Rao

  35. Allam Appa Rao

  36. Protein folding ? The ability of a protein to fold reliably into a pre-determined conformation despite a near infinite number of possibilities is, despite much research, still poorly understood. The structure of a protein is determined purely by the amino acid sequence, and the structure of the protein determines the function. The function of a protein depends entirely on the ability of the protein to fold rapidly and reliably to its native structure. Many proteins fold spontaneously into their native structure in aqueous solution. It has been suggested that for a protein of 100 amino acids, a purely random conformational search would require around 10 **29 years, and yet proteins are able to fold on a timescale of milliseconds to seconds. This suggests that only a small amount of conformational space is sampled during the folding process and this in turn implies the existence of kinetic folding pathways. This paradox of how proteins fold rapidly and reliably to their native conformation is known as the protein folding problem. Allam Appa Rao

  37. Statistics is essence of making sense Allam Appa Rao

  38. George Gamow (1904-68) Application of Shannon’s information theory breaks genetics and molecular biology out of the descriptive mode into the quantitative mode Allam Appa Rao

  39. Shannon - Information Flow • Information flow in an information theoretical context is the transfer of information from a variableh to a variable l in a given process. • The measure of information flow, p • P is defined as the uncertainty before the processstarted minus the uncertainty after the process terminated. This can be quantified as • where H (h | l) is the conditional entropy (equivocation) of variable h (before the process started) given the variable l (before the process started), and H(h | l') is the conditional entropy (equivocation) of variable h (before the process started) given the variable l' (the value of variable l after the process finished). • H(X,Y) is the joint entropy, and can be calculated as follows: Gene Protein Allam Appa Rao

  40. Information in living organisms One of the prime characteristics of all living organisms is the information they contain for all operational processes • Braitenberg, a German cybernetist, has submitted evidence ‘that information is an intrinsic part of the essential nature of life.’ The transmission of information plays a fundamental role in everything that lives. • Without a doubt, the most complex information processing system in existence is the human body. If we take all human information processes together, that is, conscious ones (language, information-controlled functions of the organs, hormone system), this involves the processing of 1024 bits daily. • This astronomically high figure is higher by a factor of 1,000,000 than the total human knowledge of 1018 bits stored in all the world’s libraries. Allam Appa Rao

  41. Allen Turing and Gatlinburg symposium on information theory in biology The logic of Turing machines has an isomorphism with the logic of the genetic information system • Information Source • Transmission of Information • Tasks to be completed • Output • Information source: DNA • Transmission through m/t/r RNA • Tasks: Transcription, translation • Output: Protein(s) Allam Appa Rao

  42. Information Theory, Evolution, and the Origin of Life Hubert P. Yockey, pp 35 Allam Appa Rao

  43. Shannon, Turing, Gamow and Rao H (gene) L (protein) Information Transfer Process Allam Appa Rao

  44. The word "information" derives from the Latin, informare, which means "to put into form” Latent Manifest Readily seen, or understood: apparent, clear, evident, noticeable, observable • Existing or present • but concealed or inactive DNA Protein Allam Appa Rao

  45. How does the code work? Inherited disease: broken/ damaged dna  broken/ damaged proteins Viral disease: dna/rna  foreign proteins (Akin to Computer VIRUS) • Template for construction of proteins Manifestation Latent Information Manifested Information Allam Appa Rao

  46. Genomic Information ACGTCCGGCCTTATACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAGACGCTAATAAGCGCTCTATGTCTATACGCGCGATGCCGTACGAG… What good is all this genetic information? Allam Appa Rao

  47. Information Inheritance • Human beings are endowed with the information encoded in the genetic material of inheritance which controls the development, reproduction and self-repair. • The carrier of this information is a complex structure of dna. Allam Appa Rao

  48. Anything Computable! • Markov defined what became known as Markov algorithms (HMM) for biological computation • Alonzo Church used Lambda calculus for computing • Kurt Gödel defined Recursive functions Allam Appa Rao

  49. Genetic Information Flow • Within the body, genetic information flows from dna to protein and other products • first, by the transcription of portions of the dna into so-called messenger rna and, • second, by (translation) the assembly of individual amino acids into polypeptides, including proteins. This is the process of life and living related to information flow. Allam Appa Rao

  50. The new Challenges in Computer Science • Promoter recognition in genomic sequence, • Understanding data from micro array experiments, and • Accurate prediction of protein folds from sequences Allam Appa Rao

More Related