'Genes involved' diaporamas de présentation

EPI 6181 Beth Lowcock 22 November, 2004

574 views • 57 slides

Ageing 2: Cancer

Ageing 2: Cancer. Review : The force of natural selection declines with ageing due to increase in extrinsic mortality (= weakening of natural selection) and reduction in reproduction with age (selection acts at reproduction). Review.

687 views • 56 slides

511 views • 51 slides

Towards an understanding of Genotype-Phenotype correlations

Towards an understanding of Genotype-Phenotype correlations. Paul Fisher et al.,. Genotype. The entire genetic identity of an individual that does not show any outward characteristics, e.g. Genes, mutations. Genes. DNA. Mutations. ACTGCACTGACTGTACGTATATCT ACTGCACTG TG TGTACGTATATCT.

539 views • 37 slides

A Systematic approach to the Large-Scale Analysis of Genotype-Phenotype correlations

A Systematic approach to the Large-Scale Analysis of Genotype-Phenotype correlations. Paul Fisher Dr. Robert Stevens Prof. Andrew Brass. Genotype. The entire genetic identity of an individual that does not show any outward characteristics, e.g. Genes, mutations. Genes. DNA. Mutations.

464 views • 30 slides

Transcription and Translation Practice

493 views • 30 slides

MRC Laboratory of Molecular Biology Cambridge

Evolution of transcription factors from selfish elements: The tale of Rcs1, a global regulator of cell size in yeast. M. Madan Babu. MRC Laboratory of Molecular Biology Cambridge. Evolution of biological systems. Evolution of networks within and across genomes.

276 views • 26 slides

A Gene Expression Screen

A Gene Expression Screen. Zhou Wang and Donald D. Brown. Presented By: Neema Izadi. Introduction. In Amphibian Tadpole Thyroid hormone is known to cause tail degeneration. Study done to figure out which genes are up regulated and down regulated. Used genetic screening

208 views • 20 slides

Additional File 7 K-means cluster graphs (15 clusters)

Additional File 7 K-means cluster graphs (15 clusters). Middle G1. Early G1. Late G1. Early S. Late S. G1/S. G2. M. Middle G1. Early G1. Late G1. Early S. Late S. G1/S. G2. M. Middle G1. Early G1. Late G1. Early S. Late S. G1/S. G2. M.

265 views • 17 slides

Identifying new genes involved in the DNA damage checkpoint pathway

Identifying new genes involved in the DNA damage checkpoint pathway. Courtney Onodera March 16, 2005. Overview of pathway. http://biochem.wustl.edu/~burgersw3/checkpointtxt.htm. Motivation. Lokey lab - cancer research (therapeutics) Wet lab experiments: Knock out genes with RNAi

244 views • 14 slides

Engineering a simpler pheromone response pathway

Engineering a simpler pheromone response pathway. Alex Mallet Endy Lab MIT. Regulation of pheromone pathway (Dohlman and Thorner, 2001). Transcriptional complexity. Transcriptional response ~ 200 genes upregulated, ~200 genes downregulated after exposure to pheromone (Roberts et al, 2000)

147 views • 14 slides

Project Work

135 views • 12 slides

Gene Expression in Early Stages of Micorrhizal Interactions

Gene Expression in Early Stages of Micorrhizal Interactions. By Sahel Arora. a mutualistic symbiosis between plant and fungus 2 major types Endomycorrhizae-- fungal component are Glomales Endomycorrhizae -- hyphae penetrates the outer cells of plant root. What is Mycorrhizae - review.

251 views • 9 slides

150 views • 1 slides

Prognostic Markers for Response and and Overall Survival in Patients with Adenocarcinoma

Prognostic Markers for Response and and Overall Survival in Patients with Adenocarcinoma Treated with Neoadjuvant Therapy J.M. Leers 2 , G. Lurje 1 , A. Oezcelik 2, ,W . Zhang 1 , D. Yang 1 , J.A. Hagen 2 , S.R. DeMeester 2 , T.R. DeMeester 2 , and H.J. Lenz 1

97 views • 1 slides

157 views • 1 slides

Sucrose transporter

Cytoplasm. Chroloplast. Triose-P translocator. Vacuole. Sucrose. Sucrose transporter. Sucrose. Transport to sink organs.

148 views • 1 slides