'Last match' diaporamas de présentation

Finding substrings

Finding substrings. my $sequence = "gatgcaggctcgctagcggct"; #Does this string contain a startcodon? if ($sequence =~ m/atg/) { print "Yes"; } else { print "No"; }. Finding substrings. my $sequence = " gatgcaggctcgctagcggct"; #Does this string contain a startcodon ?

291 views • 21 slides

Alliances, Eliminations and Scouting

Alliances, Eliminations and Scouting. Evan Morrison Mentor, Teams 190 and 971. Overview. Objectives: Understand how the FIRST tournament structure works Topics: The Real Deal on Alliances (What they are and how they work)

125 views • 12 slides

Television

215 views • 12 slides

Football History

Football History. Yara 7A. Introduction .

282 views • 7 slides

Monday August 18, 2008

195 views • 5 slides