'Print word' diaporamas de présentation

656 views • 54 slides

Control flow File handling

572 views • 47 slides

Guide to Programming with Python

Guide to Programming with Python. Chapter Four Strings, and Tuples; for Loops: The Word Jumble Game. Objectives. Data type: sequences (containers) Strings (a sequence of letters) Tuples (a sequence of elements of any type; immutable) Lists (a sequence of elements of any type; mutable)

371 views • 30 slides

Guide to Programming with Python

Guide to Programming with Python. Chapter Four Strings, and Tuples; for Loops: The Word Jumble Game. Objectives. Data type: sequences (containers) Strings (a sequence of letters) Tuples (a sequence of elements of any type; immutable) Lists (a sequence of elements of any type; mutable)

317 views • 30 slides

Functions

Functions. Functions. A set of statements (lines of code) that can be run repeatedly Goals: Learning Python by Lutz and Ascher Code reuse Procedural decomposition. Top-Down Design. Break problem into subproblems Print HIHO in block letters print H print I print H print O

391 views • 23 slides

Finding substrings

Finding substrings. my $sequence = "gatgcaggctcgctagcggct"; #Does this string contain a startcodon? if ($sequence =~ m/atg/) { print "Yes"; } else { print "No"; }. Finding substrings. my $sequence = " gatgcaggctcgctagcggct"; #Does this string contain a startcodon ?

212 views • 21 slides

299 views • 20 slides

Week 3

Week 3. parameters, return, math, graphics Special thanks to Scott Shawcroft, Ryan Tucker, and Paul Beck for their work on these slides. Except where otherwise noted, this work is licensed under: http://creativecommons.org/licenses/by-nc-sa/3.0. Parameters.

173 views • 17 slides

NLTK & Python Day 6

238 views • 15 slides

Logo -- A Language for Learning

607 views • 14 slides

245 views • 11 slides

RESUME WRITING-Part 1

RESUME WRITING-Part 1. Mr. Endicott Career Class. What is a Resume?. A resume is a short document that details your qualifications for a job. How much time do you think someone will look at your resume?. About 20 seconds. What are the 3 types of resumes?. Print- Word, etc.

290 views • 9 slides