1 / 21

Protein Synthesis

Protein Synthesis. Living Environment. What are proteins? Chains of Amino Acids connected to one another by peptide bonds . Have a specific shape and function. Examples: Enzymes Hormones Antibodies Hemoglobin. Review. What is the difference between DNA & RNA?.

stephenw
Télécharger la présentation

Protein Synthesis

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Protein Synthesis Living Environment

  2. What are proteins? • Chains of Amino Acids connected to one another by peptide bonds. • Have a specific shape and function. • Examples: • Enzymes • Hormones • Antibodies • Hemoglobin Review

  3. What is the difference between DNA & RNA?

  4. The process of making proteins. • Proteins make up everything in our bodies and control our physical characteristics. • Example(s): proteins, enzymes, hormones, antibodies, and hemoglobin. What is Protein Synthesis ?

  5. The building blocks of proteins: Amino Acids • Protein function is determined by the shape and order/sequence of Amino Acids. The building blocks…

  6. DNA’s job is to code for (make) a protein. • DNA contains the instructions for making all proteins. • Each gene in the DNA will code for a protein. • ***** The order for the nitrogen bases in a strand of DNA will determine the Amino Acids order*** DNA’s job in protein synthesis…

  7. 1. Transcription (in the nucleus) 3. Translation (out of the nucleus) Protein Synthesis contains 3 steps… 2. mRNA strand leaves the nucleus

  8. The first step… • This is when the DNA molecule “unzips” and a strand of mRNA is created. • ***This happens in the nucleus!*** • A  U • T  A • C  G • G  C • Example: • DNA: T G C C G A A T C G A T • mRNA: A C G G C U U A G C U T 1. Transcription(in the nucleus)

  9. Transcription

  10. DNA: ATC GCA AGC TAT • RNA: • DNA: TAC TGG CGA ATC • RNA: Transcription practice…

  11. The mRNA (messenger RNA ) leaves the nucleus and goes to the ribosomes. Step 2

  12. The mRNA acts as a code that tells the tRNA which Amino Acids to bring over. • Codon: set of three Nitrogen bases • Each codon “codes for” one Amino Acid Step 3 Translation (out of the nucleus)

  13. Circle the codon!

  14. DNA original template strand: T G C C G A A T C G A T • mRNA strand: A C G G C U U A G C U A • mRNAbroken up into codons: ACG/GCU/UAG/CUA

  15. mRNA broken up into codons: ACG/GCU/UAG/CUA • Amino Acids: HOW? Write out the amino acids...

  16. Steps: Use the left side to find the first letter in the codon. Use the top to find the second letter in the codon. Use the right side to find the third letter of the codon. Find where they match up. How do we read this chart?

  17. Start Codon: The first codon in the transcribed mRNA that undergoes translation • Stop Codon: These codons signal the end of the polypeptide chain during translation. What are start and stop codons?

  18. mRNA broken up into codons: ACG/GCU/UAG/CUA • Amino Acids: Lets practice… THR/ LEU ALA/ STOP/

  19. Example:

  20. Overall…

  21. DNA template strand: GAGTGTGTTGAACGATGCTCTACTCATCGTTGGGTT • mRNA: CUCACACAACUUGCUACGAGAUGAGUAGCAACCCAA • Codon: LEU/THR/GLN/LEU/ALA/THR/ARG/STOP/VAL/ALA/THR/ILE Demo

More Related