1 / 24

Norton Knatchball visit (12 th & 13 th July)

Norton Knatchball visit (12 th & 13 th July). 10:00 Welcome and lab safety 10:15 Practical work. 1. Pouring gels 2. Restriction enzyme digests 3. Gel loading and electrophoresis 12:45 Lunch 13:15 Talk 13:45 Imaging of gels and PCR demonstration. 14:30 Depart. Safety in the lab.

taline
Télécharger la présentation

Norton Knatchball visit (12 th & 13 th July)

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Norton Knatchball visit (12th & 13th July) 10:00 Welcome and lab safety 10:15 Practical work. 1. Pouring gels 2. Restriction enzyme digests 3. Gel loading and electrophoresis 12:45 Lunch 13:15 Talk 13:45 Imaging of gels and PCR demonstration. 14:30 Depart

  2. Safety in the lab Wear lab coat. Wear disposable gloves. Do not eat and drink in the lab Wash your hands before leaving. ! ! ! WARNING! ELECTRICAL SHOCK WARNING! MUTAGENIC SUBSTANCE WARNING! UV RADIATION WARNING! NAKED FLAME & BOILING LIQUID Electrophoresis Make sure lid is taped down. Set up power pack with demonstrator Gel illumination Make sure orange perspex lid is down. SYBR-Safe DNA stain Wear gloves when handling gels containing SYBR-safe Melting agarose Do not leave unattended. Do not work or sit in immediate vicinity. Use mitts.

  3. DNA

  4. DNA Structure (1953) X-ray diffraction pattern

  5. Bases Sugar & phosphate Bases 5’ 3’ Sugar Phosphate 3’ 5’ The two strands are complementary to each other Double helix - the structure determined by Watson & Crick

  6. The structure revealed how DNA canto be copied DNA replication Quote from paper: “It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material.”

  7. EcoR1 (Escherichia coli) GAATTC CTTAAG BamH1 (Bacillus amyloliquefaciens) GGATCC CCTAGG HindIII (Haemophilus inflenzae) AAGCTT TTCCAA DNA is easy to isolate – but to handle it you need to be able to cut it at specific sites and isolate the fragments. Restriction enzymes – discovered in bacteria – natural defence from viral DNA Bacteriophage Several hundred restriction enzymes now available. Provide a range of cutting specificities. Some leave blunt ends, others “sticky” ends.

  8. Enzyme recognition site Plasmid Sticky ends Foreign DNA Cut plasmid Recombinant plasmid “Sticky ends” allow simple incorporation of foreign DNA fragments into bacterial plasmids Electron micrograph of a plasmid

  9. Separation and purification – Agarose Gel Electrophoresis Individual bands can be cut from the gel with a scalpel and then extracted from the agarose slice.

  10. Alec Jeffreys

  11. Person A Person B DNA Restriction enzyme (eg EcoR1) Tandem repeats (9) Person A ATTG ATTG ATTG ATTG ATTG ATTG ATTG ATTG ATTG Tandem repeats (15) Person B ATTG ATTG ATTG ATTG ATTG ATTG ATTG ATTG ATTG ATTG ATTG ATTG ATTG ATTG ATTG The high specificity of restriction enzymes allows individuals to be recognised from the pattern of fragment sizes (retriction fragment length polymorphism) The size of some fragments will vary in size due to differences in the DNA sequence, eg. tandem repeat regions within the genome:

  12. The fragments containing the repeat regions can be identified by separating the digest by electrophoresis and then blotting the bands onto a nylon membrane (Southern blot). A B Person A A B Electrophoresis Transfer to nylon membrane (blot) Person B Separation of DNA fragments Blot DNA fragments

  13. The bands containing the tandem repeat region are identified with a short stretch of complementary DNA labelled with a radioactive probe. A B A B A B Incubation with a labelled DNA probe Detection of radioactivity (photographic film) Blot Blot

  14. How do complementary oligonucleotide probes bind? 5’CCGTATAGGTTG3’ Labelled with 32P + 5’ 3’ …CTAGGTGTCCGAATGGGCACTAGGTCGCTCAACCTATACGGTACTTTACTCA… 5’ 3’ …CTAGGTGTCCGAATGGGCACTAGGTCGCTCAACCTATACGGTACTTTACTCA… 5’CCGTATAGGTTG3’

  15. First DNA fingerprint used as evidence in court Ghana Immigration case 1985 Multi-locus probe – ie. identifies more than site in the genome.

  16. Single locus probes easier to interpret: Analysis using a single locus probe for a tandem repeat region Child 1 Father Child 2 Child 4 Child 3 Mother Why are two bands for each individual seen?

  17. Analysis with 2 single locus probes Who is the father of the child? Lanes: 1 – Mother 2 – Child 3 – Father A? 4 – Father B? Biological father An alternative way to generate fragments of DNA and to carry out DNA fingerprinting is to use PCR (polymerase chain reaction)

  18. Polymerase Chain Reaction (PCR) CYCLE 1: (95oC) (about 50oC) (72oC) X2 DNA polymerase

  19. Denaturation Annealing and extension CYCLE 2: X4

  20. CYCLE 3, 4, etc.: Denaturation, annealing & extension X8 Denaturation, annealing & extension X16

  21. Analysis of a PCR reaction by gel electrophoresis should show a single band.

  22. PCR can be used to amplify tandem repeat regions for DNA fingerprinting. The size of the fragment can be measured directly using capillary electrophoresis. Typically 20 different repeat regions are measured making as possibility of a match occurring by chance very small. Tandem repeat region PCR Electrophoresis Peaks at 16 and 22 repeats 15 25 30 20 10 Size (number of repeats)

  23. Victim Real data… Suspect Bloodstain from crime scene

  24. Lambda DNA cleavage with BamH1, EcoR1 and HindIII From: http://tools.neb.com/NEBcutter2/index.php Lambda DNA sequence available from: www.cf.ac.uk/biosi/staff/ehrmann/tools/dna/PhageLambda.html

More Related