1 / 5

Suppl. Figure 1

Suppl. Figure 1. Pituitary Tumors. Normal. miR-107 levels. miR-145 levels. miR-103 levels. miR-143 levels. Normal. Pituitary Tumors. miR-125b levels. miR-15b levels. miR-141 levels. miR-16 levels. miR-144 levels. miR-186 levels. miR-164 levels. let-7b levels.

Télécharger la présentation

Suppl. Figure 1

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Suppl. Figure 1 Pituitary Tumors Normal miR-107 levels miR-145 levels miR-103 levels miR-143 levels Normal Pituitary Tumors miR-125b levels miR-15b levels miR-141 levels miR-16 levels miR-144 levels miR-186 levels miR-164 levels let-7b levels Suppl. Figure 1. Evaluation of the expression levels of differentially expressed microRNAs between pituitary normal and cancer tissues. MicroRNA expression levels were assessed by real-time PCR analysis in 5 normal and 12 cancer pituitary tissues. The experiment has been performed in triplicate and data are shown as mean ± SD.

  2. Suppl. Figure 2 8-mer 8-mer 3’UTR BMI1 UGUGCAGCCACGUCACUGUGA 3’UTR PTEN UGUUAGGGAAUUUUACUUGAA miR-128 UUUCUCUGGCCAAGUGACACU miR-26b UGGAUAGGACUUAAUGAACUU BMI1 1 459-65 1654 PTEN 1 1278-84 3295 3’ UTR 3’ UTR Suppl. Figure 2. Sequence complementarity between miR-26b and the 3’UTR of PTEN gene and between miR-128 and the 3’UTR of BMI1 gene.

  3. Suppl. Figure 3 a # of colonies # of colonies - + - - - - + - - - as-miR NC as-miR NC - - + + + - - + + + as-miR-26b as-miR-128 - - - + - - - - + - siRNA NC siRNA NC - - - - + - - - - + siRNA-PTEN siRNA-BMI1 b # of invading cells # of invading cells - + - - - - + - - - as-miR NC as-miR NC - - + + + - - + + + as-miR-26b as-miR-128 - - - + - - - - + - siRNA NC siRNA NC - - - - + - - - - + siRNA-PTEN siRNA-BMI1 Suppl. Figure 3. MiR-26b and miR-128 control the tumorigenicity and invasiveness of AtT-20 pituitary tumors cell through regulation of PTEN and BMI1, respectively. (a) Number of colonies (mean ± SD) and (b)invading AtT-20 cells untreated or treated with 50nM antisense-microRNA negative control (as-miR-NC), antisense-microRNA-26b (as-miR-26b), antisense-microRNA-128 (as-miR-128), siRNA negative control (siRNA NC) and siRNA against PTEN (siRNA-PTEN).

  4. Suppl. Figure 4 b c a p<0.0001 # of invading cells - + - - - - miR-NC - - + - - - as-miR-NC - - - + - + as-miR-26b - - - - + + miR-128 d e f PTEN mRNA levels AKT phosph levels # of invading cells # of colonies p<0.0001 - + - - - - # of colonies - + - - - - miR-NC miR-NC - - + - - - - - + - - - as-miR-NC as-miR-NC - + + + as-miR-26b - - - + - + Suppl. Figure 4. MiR-26 and miR-128 regulate the PTEN-AKT pathway in AtT-20 pituitary cells. (a)Number of colonies and (b) invading AtT-20 cells, untreated or treated with 50nM miR-NC, as-miR-NC, as-miR-26b and miR-128. (c) Fold enrichment of BMI1 in the promoter area of PTEN in AtT-20 cells treated with 50NM as-miR-NC or as-miR-128, assessed by chromatin immunoprecipitation followed by real-time PCR analysis. (d) PTEN mRNA expression levels (mean ± SD) assessed by real-time PCR analysis and (e)AKT phosphorylation levels (S473) in AtT-20 cells treated for 48h with 50nM as-miR-NC, as-miR-128, miR-26b and their combinations. (f) Number of colonies and invading AtT-20 cells, untreated or treated with 50nM as-miR-26b and miR-128 or combination of as-miR-26b, miR-128 and siRNA NC or combination of as-miR-26b, miR-128 and siRNA-PTEN. The experiments have been performed in triplicate and data are shown as mean ± SD. - - - + - + as-miR-128 as-miR-128 - + + + - + + + as-miR-26b miR-128 - - - - + + - - - - + + miR-26b miR-26b - + + + - - + + miR-128 siRNA NC - + - - - - - - + + - - - + miR-NC siRNA NC siRNA-PTEN - - + - - - - - - + as-miR-NC siRNA-PTEN - - - + - + as-miR-26b - - - - + + miR-128

  5. Suppl. Figure 5 # of invading cells GH3 MtT/S - + + + as-miR-26b - + + + miR-128 - - + + siRNA NC - - - + siRNA-PTEN Suppl. Figure 5. Number of invading GH3 and MtT/S cells, untreated or treated with 50nM as-miR-26b and miR-128 or combination of as-miR-26b, miR-128 and siRNA NC or combination of as-miR-26b, miR-128 and siRNA-PTEN. The experiments have been performed in triplicate and data are shown as mean ± SD.

More Related