1 / 40

DNA Microarrays for Biomedical Research: Wonders and Cautions

DNA Microarrays for Biomedical Research: Wonders and Cautions. Daniel R. Salomon, M.D. Department of Molecular and Experimental Medicine The Scripps Research Institute. If you don’t understand anything today - it is my fault. This is just technology. 300-500,000 Proteins. What is a gene?.

tave
Télécharger la présentation

DNA Microarrays for Biomedical Research: Wonders and Cautions

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. DNA Microarrays for Biomedical Research: Wonders and Cautions Daniel R. Salomon, M.D. Department of Molecular and Experimental Medicine The Scripps Research Institute

  2. If you don’t understand anything today - it is my fault. This is just technology.

  3. 300-500,000 Proteins What is a gene? 30-35,000 Open Reading Frames (ORFs) Genome Transcriptosome Proteosome

  4. Environment: ECM, Ischemia, Stress Growth Factors Cytokines Development/Differentiation Programs Baseline/Constitutive Activated What happens immediately, what happens next?

  5. Tissues are complex mixtures of different cell types. Infiltrating Inflammatory Cells Endothelium Epithelium Mesenchymal Elements

  6. How are signal pathways regulated by transcription?

  7. Gene Discovery vs. Custom Arrays • “Gene Discovery Arrays” Affymetrix GeneChips Incyte Rosetta Filter arrays • “Custom DNA Microarrays” Low-cost Replicate data points Focused sets of genes

  8. Affymetrix Chip Technology

  9. Affymetrix: Photolithography-based Gene Chip Printing

  10. Affymetrix Chip System Chip Hybe/Wash Station Array Scanner Informatics Work Station

  11. Processing Microarray Image Data - Step 1 Scanning Image Red - Cy5 Green - Cy3 Yellow - Both

  12. Processing Microarray Image Data - Step 2 Creating an image mask

  13. Processing Microarray Image Data - Step 3 Analyzing probe intensity at a single spot

  14. Processing Microarray Image Data - Step 4 Comparing multiple time points or conditions

  15. Image Analysis • ImaGene (Biodiscovery) • QuantArray (GSI Lumonics) • Affymetrix GeneChip software

  16. Data Analysis • Excel • GeneSpring (Silicon Genetics) • Affymetrix GeneChip software • Cluster/Treeview (Stanford) • NFUEGO, Promoter Cruncher, Chip Annotation databases

  17. Image files (from Affymetrix or Custom slide arrays) Microarray specs Patient/Clinical data To Web Database Server Annotation Database Promoter Cruncher User Workstations ImaGene, GeneSpring, Cluster/Treeview GeneChip, NFUEGO

  18. A C B

  19. Affymetrix Chip HG U95A

  20. Incyte Genomics: Human UniGene I Array (8393 unique genes or ESTs) Clone ID Accession # Gene Name 1362728 AF068236 nitric oxide synthase 2A (inducible, hepatocytes) 1363074 BF035921 lymphocyte cytosolic protein 1 (L-plastin) 1363684 NM_014823 KIAA0344 gene product 1363832 NM_006405 transmembrane 9 superfamily member 1 1364004 AA778107 Homo sapiens mRNA; cDNA DKFZp586O2124 1364225 AW136140 Homo sapiens cDNA: FLJ23053 fis, clone LNG02858 1365434 AI627624 zinc finger protein 195 1365507 BE045743 LBP protein 32 1365962 U75898 heat shock 27kD protein 2 1365975 AA595575 Homo sapiens cDNA: FLJ23516 fis, clone LNG04848 1366043 BE043061 Homo sapiens cDNA FLJ12366 fis, clone MAMMA1002411 1366085 NM_001129 AE-binding protein 1 1366602 AI416967 MUM2 protein 1366614 N68666 f-box and leucine-rich repeat protein 7 1366817 R58925 EST 1366978 AF007170 DEME-6 protein 1367201 AI754198 KIAA0076 gene product 1367516 AA813998 ESTs 1367527 AF072164 HsHomo sapiens HSFE-1 mRNA, partial cds 1367862 H39214 ESTs 1368173 Y00698 phosphofructokinase, muscle 1368319 AA348317 ESTs 1368493 AK000005 FLJ00005 protein 1368653 X57548 cadherin 2, type 1, N-cadherin (neuronal)

  21. http://www.gene.ucl.ac.uk/cgi-bin/nomenclature/ Human Gene Nomenclature Database: Genew3 Search Search of Approved Symbols AND Literature Aliases from this page [help] This public copy of the database was last updated on Wed Apr 11, 2001 Now containing 12892 active gene symbols and 8700 literature aliases and 2634 withdrawn symbols Quick search by first letter of symbol [help] ABCDEFGHIJKLMNOPQRSTUVWXYZ

  22. Page 1 of 4: Cadherins Symbol Full Name Cytogenetic Location PubMed ID CDH1 cadherin 1, type 1, E-cadherin (epithelial) 16q22.1 9925936 CDH2cadherin 2, type 1, N-cadherin (neuronal) 18q12.1 2384753 CDH3 cadherin 3, type 1, P-cadherin (placental) 16q22.1 1427864 CDH4 cadherin 4, type 1, R-cadherin (retinal) 20q13.3 10191097 CDH5 cadherin 5, type 2, VE-cadherin reserved 2059658 CDH6 cadherin 6, type 2, K-cadherin (fetal kidney) 5p14-p15.1 7743525 CDH7 cadherin 7, type 2 18q22-q23 9615235 CDH8 cadherin 8, type 2 16q22.1 9615235 CDH9 cadherin 9, type 2 (T1-cadherin) reserved 2059658 CDH10 cadherin 10, type 2 (T2-cadherin) 5p13-p14 2059658 CDH11 cadherin 11, type 2, (osteoblast) 16q22.1 9615235 CDH12 cadherin 12, type 2 (N-cadherin 2) 5p14-p13 7731968 CDH12P cadherin 12 (N-cadherin 2) pseudogene 5q137731968 CDH13 cadherin 13, H-cadherin (heart) 16q24.2 8673923 CDH15 cadherin 15, M-cadherin (myotubule) 16q24.3 1427864 CDH16 cadherin 16, KSP-cadherin 16q21-q22 9721215 CDH17 cadherin 17, LI cadherin (liver-intestine) 8q22.2-q22.3 9615235 CDH18 cadherin 18, type 2 5p15.1-p15.2 9030594 CDH19 cadherin 19, type 2 18q22-q23 CDH20 cadherin 20, type 2 18q22-q23 CDH21 cadherin 21 reserved CDH23 cadherin related 23 10q21-q22 11090341 CDH24 cadherin-like 24 reserved

  23. PubMed Reference for Cadherin 2 N-cadherin gene maps to human chromosome 18 and is not linked to the E-cadherin gene. Walsh FS, Barton CH, Putt W, Moore SE, Kelsell D, Spurr N, Goodfellow PN. Department of Experimental Pathology, UMDS, Guy's Hospital, London, England. cDNA clones encoding the human N-cadherin cell adhesion molecule have been isolated from an embryonic muscle library by screening with an oligonucleotide probe complementary to the chick brain sequence and chick brain cDNA probe lambda N2. Comparison of the predicted protein sequences revealed greater than 91% homology between chick brain, mouse brain, and human muscle N-cadherin cDNAs over the 748 amino acids of the mature, processed protein. A single polyadenylation site in the chick clone was also present and duplicated in the human muscle sequence. Immediately 3' of the recognition site in chick a poly(A) tail ensued; however, in human an additional 800 bp of 3' untranslated sequence followed. Northern analysis identified a number of major N-cadherin mRNAs. These were of 5.2, 4.3, and 4.0 kb in C6 glioma, 4.3 and 4.0 kb in human foetal muscle cultures, and 4.3 kb in human embryonic brain and mouse brain with minor bands of 5.2 kb in human muscle and embryonic brain. Southern analysis of a panel of somatic cell hybrids allowed the human N-cadherin gene to be mapped to chromosome 18. This is distinct from the E-cadherin locus on chromosome 16. Therefore, it is likely that the cadherins have evolved from a common precursor gene that has undergone duplication and migration to other chromosomal locations.

  24. http://www.gdb.org/ Search bySubmit Genomic Segments Name/GDB ID All Biological Data Keyword People DNA Sequence ID Citations Gene List - Accession #, Map Coordinates

  25. Gene Map of Chromosome 8q13.3-8q24.22 Displayed by MapView 2.4

  26. Custom Microarray Printing • Glass slide substrate • 500-10,000 spots/slide • Robotic spotting device • cDNA clones • PCR products • Oligonucleotides • (50-70mers)

  27. The Mguide: A complete guide to building your own microarrayer. http://cmgm.stanford.edu/pbrown/mguide

  28. Oligonucleotides (50-70mers) • are sequence verified • eliminate clone library banking • eliminate PCR and PCR contamination issues • are inexpensive (500ng of purified 75mer will print 12,000 arrays each with 3 replicate spots) • can be directed at specific exons to detect splice variants • can be designed to distinguish closely related genes

  29. Genotyping Gene Expression • 1-40 markers/sample • multiple samples/chip • sample tracking • automated sample and reagent handling • 2-4 color fluorescence • detection • 100-10,000 genes / chip • 1-2 samples/chip • library of array elements • high speed/high density printing • data interpretation • database management Array-based genotyping vs.gene expression analysis ::::::::::::::::::::::::: ::::::::::::::::::::::::: ::::::::::::::::::::::::: ::::::::::::::::::::::::: ::::::::::::::::::::::::: ::::::::::::::: ::::::::::::::: ::::::::::::::: :::::::::::::::

  30. Solid-phase primer extension assay:“Mini-sequencing”, “Genetic Bit Analysis (GBA)” 1. Hybridization of template DNA to solid-phase primer 5’ X=C/T polymorphism 3’ Hybridized template TACGTGACTGATGCTTAGCTTCAATGAGXTGATGTAG ||||||||||||||||||||| GACTACGAATCGAAGTTACTC Solid-phase oligonucleotide Glass slide

  31. 3mm

  32. A Microarray Strategy Gene Discovery (large arrays, limited numbers of samples) Custom DNA microarrays (small arrays, large numbers of samples) Genotyping (SNPs)

  33. The challenges for chip technology I. • Incredible amounts of “data” • An incomplete database • Technical issues involving multiple technologies • Relatively primitive tools for handling data • Major issues for statistical methodologies • Normalization • Replicates • Significant changes

  34. The challenges for chip technology II. • Major challenge to scientific thought and method • Big science or “organismal” biology • Hypothesis-driven vs. “Fishing Expedition” • How is the transcriptosome regulating the proteome?

  35. Clinical Specimens Laser Capture Microscopy RNA/Signal Amplification

More Related