Catching RIP in the act. Part I: A PCR assay to detect DNA methylation

1. Catching RIP in the act. Part I: A PCR assay to detect DNA methylation Paul Donegan Freitag Lab Biochemistry and Biophysics Department Oregon State University

2. Background • MUTAGENESIS: Mutations of base pairs in genetic material • Induced by UV, X-ray, viruses, etc. • Spontaneous occurrence • triggers DNA repair • Hypermutagenesis • Induced and controlled by cells • Not spontaneous --AID deaminase --ApoBec (HIV) --RIP

3. RIP = Repeat Induced Point Mutation Genomic defense mechanism Silences repetitive DNA (no expression) Targets duplicated DNA segments linked or unlinked sequences Induces C to T transition mutations Identical Sequences Mutated Sequences R I P RIP triggered by repeated sequence C to T point mutations induced by RIP GCATATCAGTCATGCTCAGCGCACCTA GCATATCAGTCATGCTCAGCGCACCTA GTATATCAGTTATGTTCAGTGCACTTTA GCATATTAGTTATGTTTAGCGCATTCTA

4. Relevance We are interested in RIP because we want to: • gain insights into evolutionary mechanisms that shape genomes. • understand genome defense mechanisms and mutagenesis.

5. Summer Research Objective • To differentiate between two possible molecular mechanism that can explain RIP Neurospora crassa Rosette of sexual spores, nuclei labelled with GFP

6. Possible Mechanisms for C to T Mutations caused by RIP (1) H3C METHYLATION DEAMINATION CMe C T Methyl Group Donor- S-adenosylmethionine (SAM) • Methylation by a specific cytosine DNA methyltransferase, followed by deamination

7. Possible Mechanisms for C to T Mutations caused by RIP (2) • Cytosine is never methylated but instead deaminated to uracil, which will be replaced with thymine by DNA replication or repair DEAMINATION z Enz U Intermediate C

8. RIP timeline FERTILIZATION • RIP occurs during the sexual cycle • RIP occurs after fertilization but before karyogamy. • ~10 mitotic divisions while RIP can occur. RIP ZONE! KARYOGAMY Image from: Shiu et al. (2001) Cell

9. Methylation Assay Timeline • DNA was extracted during the expected RIP timeframe • Methylation of interest should occur between fertilization and karyogamy (nuclear fusion). RIP ZONE (between fertilization and karyogamy) Controls Days of Interest 01 2 3 456 7 DAY

10. Digest with Sau3AI PCR after Digest Unmethylated site Methylated site GATC GATCme Methylation-sensitive vs. methylation-insensitive restriction enzymes: Sau3AI tests for cytosine methylation, based on the presence or absence of bands Digest PCR • DpnII is not sensitive to cytosine methylation: • -cuts regardless • -control (never amplifies) Bands cannot be amplified when site is cut

11. RFP Mutations in the RFP region • ‘tdimerRed’ has two identical segments that trigger RIP • integrated into the Neurospora genome (not in WT) • here, we look for DNA methylation induced by RIP • EVIDENCE OF METHYLATION SUGGESTS MECHANISM 1

12. Genomic DNA (Neurospora) Plasmid DNA RFP- RFP+ wild type RFP+ Primers: A B C A B C Primers: A B C A B C * * * * * * * * * * * * * * Experimental Control RFP amplification Primers 1+3 (A) and 2+3 (B) amplified RFP bands only from RFP+ strain Primers 5+6 (C) amplified control gene (hpo) Bands from 5/6 appear in all genomic DNA’s but are absent in both plasmids 1 * * 6 5 hpo 2 3 RFP region

13. BUT: Assay never worked with positive controls of methylated DNA hpo  G S D G S D Positive control: Methylated region Negative control: Unmethylated region Expected band in S lane, but no band in D lane Expected no band in S or D lane 28 cycles 25 cycles 31 cycles G = genomic DNA, no digest S = Sau3AI, C-methylation sensitive D = DpnII, C-methylation insensitive

14. Catching RIP in the act.Part II: Tagging of duplicated DNA with fluorescent DNA binding proteins

15. Goals • Tag DNA of Neurospora crassa with fluorescent proteins: • to visualize pairing of duplications during RIP; • to track chromosome territory movement (e.g., centromeres, telomeres, nucleolar DNA, specific genes) • to track movements of DNA binding proteins from nucleus to nucleus • to target enzymes to specific regions on chromosomes

16. During RIP RFP GFP RFP GFP RFP GFP RFP GFP Protein tags Specific DNA binding proteins recognize target sequences (binding sites, BS). Tag = translational fusion of a DNA binding domain (DBD) to RFP or GFP. Binding sites recruit DBD-GFP or DBD-RFP fusion; co-localization = yellow. Tagging with RFP or GFP DBD DBD RFP GFP BS BS Protein Protein DNA DNA

17. Construction of protein tags Amplified DBD from Aspergillus AflR and AlcR by PCR 1 Generated translational fusions by cloning into gfp and rfp plasmids 2 Transformed E. coli 3 Purified plamids, digested DNA and confirmed correct plasmids 4 Linearized plasmid and transformed into Neurospora his-3 mutant 5 Selected His+ Neurospora transformants that showed fluorescence 6 AlcR-RFP AflR-GFP Fusion proteins localized in nuclei

18. Construction of DNA binding sites Binding site: DNA sequences specifically recognized by AflR or AlcR 2 AflR:TCGNNNNNCGA AlcR:GCGGRRCCGC Need 200+ copies of recognized sequence to bind enough fluorescent protein for visibility.

19. Summary PCR assay: Did not work in many attempts. We need a new approach. 1 DNA tagging: The protein tags are expressed, binding sites still needed. 2

20. Acknowledgements • HHMI (Howard Hughes Medical Institute) • URISC (Undergraduate Research, Innovation,
Scholarship & Creativity) • Kevin Ahern • Michael Freitag • Kristina Smith • Freitag Lab