1 / 18

From Big Data to Relevant data: Ribo-seq and its applications

From Big Data to Relevant data: Ribo-seq and its applications Pasha Baranov "NGS Data after the Gold Rush“ Norwich, UK, May 2014. Porridge volume, log. time. What to sequence?. Lung cancer. Genetics: up to 2.4 higher chance than general population.

varuna
Télécharger la présentation

From Big Data to Relevant data: Ribo-seq and its applications

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. From Big Data to Relevant data: Ribo-seq and its applications Pasha Baranov "NGS Data after the Gold Rush“ Norwich, UK, May 2014 Porridge volume, log time

  2. What to sequence? Lung cancer Genetics: up to 2.4 higher chance than general population. 80-90% of lung cancer cases attributed to smoking. DNA RNA-seq Median age of lung cancer occurrence in US is 70 years. RNA ? Protein

  3. Ribosomal profiling (ribo-seq) Ingolia et al (2009) Science 324: 218-23 Lysis, RNA digestion

  4. Ribosomal profiling (ribo-seq) Ingolia et al (2009) Science 324: 218-23 Lysis, RNA digestion Density gradient or cushion separation

  5. Ribosomal profiling (ribo-seq) Ingolia et al (2009) Science 324: 218-23 Lysis, RNA digestion Density gradient or cushion separation Decircularization Adaptor ligation RT PCR Circularization Differential gene expression analysis Alignment to a reference sequence Sequencing

  6. mRNA level is only approximation of protein synthesis Immediate response to oxidative stress (1 hour) Andreev et al 2014 submitted

  7. How do you know what is translated? CTGGAAGAAGTAAACGCCGAGCTGGAACAGCCGGATGTCTGGAACGAACC G R S K R RA G T A G C L E R T Frame 1 L E EV N A E L E Q P D V W N E P Frame 2 W K K* T P S W N S R M S G T N P Frame 3

  8. Triplet periodicity CAGCTAGTGCGTGCTGTC 123123123123123123

  9. Triplet periodicity CAGCTAGTGCGTGCTGTC 123123123123123123

  10. Triplet periodicity CAGCTAGTGCGTGCTGTC 123123123123123123

  11. Triplet periodicity CAGCTAGTGCGTGCTGTC 123123123123123123

  12. Triplet periodicity CAGCTAGTGCGTGCTGTC 123123123123123123

  13. Triplet periodicity CAGCTAGTGCGTGCTGTC 123123123123123123

  14. Triplet periodicity N+1 N+2 N+3

  15. Switches between reading frames can be seen on ribosome profiles Human Antizyme 1 mRNA Michel et al 2012 Genome Res 22:2219-2229

  16. uORFs & nORFs Michel et al 2012 Genome Res 22:2219-2229

  17. GWIPS-viz http://gwips.ucc.ie

  18. Acknowledgments Dual coding: Audrey Michel University College Cork: Choudhury, Atkins Berkley: Ingolia Cambridge: Firth GWIPS-viz team: Audrey Michel Gearoid Fox Patrick O'Connor Stephen Heaphy Paddy Mullan Claire Donohue Romika Saini Zena Abbas Oxidative stress work: Dmitry Andreev Patrick O’Connor Moscow State University: Terenin, Dmitriev, Shatsky Trinity College Dublin: Kenny, Fahey, Cormican, Morris Financial resources:

More Related