Notes

1. Notes DNA

2. Chapter 9 WHAT IS DNA?

3. DNA= Deoxyribonucleic Acid DNA’s job is to hold the entire genetic code for the organism. Human, tree, bacteria, mushroom, paramecium, etc! ALL HAVE DNA! DNA is held on chromosomes (genes) in the NUCLEUS of every cell. DNA “codes” for all your traits. Each organism has a different strand of DNA that makes it different from all other organisms!

4. QUESTION How tall would a stack of books be that stores all of the genetic information in the DNA of ONE CELL? GUESS:

5. ANSWER As tall as a 19 story building! We have over 3 billion nitrogen bases put together in a specific way

6. IS DNA AN ORGANIC MOLECULE? Yes! Remember Nucleic Acids? (Carbohydrates, Proteins, Lipids, Nucleic Acids) Deoxyribonucleic Acid is a Nucleic Acid!

7. The structure of DNA DNA is in the form of a “twisted ladder”. This means that it looks like two ribbons twisted together. The scientific name for this is: DOUBLE HELIX

8. WATSON & CRICK In 1953, two men were credited with the discovery of the double helix. (They did not discover DNA, but they figured out what DNA looked like.) Their names were James Watson & Francis Crick.

9. DNA Notes Part 2 • DNA Structure

10. NUCLEOTIDES DNA is made of repeating DNA subunits called nucleotides that make up the entire DNA molecule. They contain the nitrogen bases, a sugar and a phosphate group. Nucleotides join together to make the long strand of DNA.

11. The bases are the “rungs” of the ladder There are four DNA bases: • Adenine (A) • Thymine (T) • Guanine (G) • Cytosine (C)

12. The sides of the ladder The sides of the ladder are made up of alternating sugars (deoxyribose) and phosphate groups.

13. DNA BASE PAIRINGS The DNA bases will always be paired in a specific way. A will always be paired with T T will always be paired with A C will always be paired with G G will always be paired with C

14. SO…………………… Because your DNA is two strands intertwined…. It will look something like this: AATGGCACCGAATCGGTCATC TTACCGTGGCTTAGCCAGTAG These two strands are called “COMPLIMENTARY SEQUENCES”

15. DIFFERENT DNA = DIFFERENT ORGANISM Will an elm tree, a deer and a bacteria have the same DNA sequence? Of course not! How about you & the person you are sitting next to? NO! Each organism, even of the same species has a different DNA sequence!

16. SIMILAR ORGANISM = SIMILAR DNA Which pair has DNA sequences closest to the other? 1. Elm Tree & Deer 2. Elm Tree & You 3. Deer & You 4. You & The Person Next To You

17. ANSWERS 1. A deer would have a closer DNA sequence to you than an elm tree (because a deer is an animal, just like you!) 2. But, the person next to you will have an even closer DNA sequence to you than either the elm tree or the deer (because you are of the same species!) 3. But—NO ONE (unless you have an identical twin) has the SAME DNA!!!!!!

18. WHAT MAKES DNA SEQUENCES DIFFERENT? The species that you belong to will determine about 99% of your gene combinations. (THESE ARE SHARED CHARACTERISTICS) It is passed along from generation to generation in the species. YOUR SPECIFIC PARENTS WILL DETERMINE THE OTHER <1% OF YOUR DNA SEQUENCE.

19. THE ORDER OF DNA BASES MAKES YOU- YOU! Even though there are only 4 nitrogen bases IN ALL THE ORGANISMS OF THE WORLD….it’s the SEQUENCE of those bases that makes the differences! The sequence ATATGACCG codes for different traits than CGGATCTAA.

20. DNA Notes 3 • DNA Replication and Protein Synthesis intro

21. WHY DO WE NEED DNA? Besides coding for all your traits, DNA helps in the process of making amino acids (which link together to form proteins). Remember…proteins are important to you because they make up the structure of your body (organs, muscles, eye balls, skin, hair, etc)

22. THREE STEPS IN PROTEIN SYNTHESIS Synthesis = Making something Gene expression is the process by which inheritable information from a gene, such as the DNA sequence, is made into a functional gene product, such as protein or RNA. Protein synthesis = making proteins • DNA replication • RNA transcription • Amino acid (protein) translation

23. 1. DNA REPLICATION Replication = copying DNA Replication means that the existing strand of DNACOPIES itself to make an exact replica. This new strand then goes to new cells (during cell division)

24. HOW DOES REPLICATION HAPPEN? • DNA is made of 2 strands (double helix). • The bases are paired up A-T, T-A, C-G, G-C. • An enzyme called a DNA helicase starts to break apart the hydrogen bonds that hold the bases together. • As the DNA ‘unzips’, new “free-floating” nucleotides attach themselves to each side of the DNA. • Two exact copies of the DNA strand now exist.

25. REPLICATION EXAMPLE ORIGINAL STRAND OF DNA: ACTACAGCATCGAGTACGCATG TGATGTCGTAGCTCATGCGTAC The original strand “unzips”: ACTACAGCATCGAGTACGCATG TGATGTCGTAGCTCATGCGTAC New bases attach themselves to the unzipped strand:

26. NEW BASES ATTACH ACTACAGCATCGAGTACGCATG TGATGTCGTAGCTCATGCGTAC TGATGTCGTAGCTCATGCGTAC ACTACAGCATCGAGTACGCATG NOW YOU HAVE 2 COPIES OF THE ORIGINAL STRAND!

27. Final Check! • There is an enzyme called a DNA polymerase that checks to make sure that there are no errors in the newly made DNA.

28. WHY REPLICATION? Why do you need EXACT COPIES of DNA whenever you create a new cell? Because if your DNA did not copy EXACTLY, you would CHANGE! What kind of changes might happen? With exact DNA, you remain the same organism.

29. DNA Notes 4 • Transcription and Translation

30. Review from Last Class on Protein Synthesis • THREE STEPS IN PROTEIN SYNTHESIS Synthesis = Making something Protein synthesis = making proteins • DNA replication • RNA transcription • Amino acid (protein) translation

31. 2. RNA TRANSCRIPTION To continue our process of making proteins for your body, we need to make RNA in a process called TRANSCRIPTION. RNA=Ribonucleic Acid (NUCLEIC ACID) RNA contains the sugar ribose. Not deoxyribose RNA is a SINGLE STRAND (ribbon) that has 4 bases.

32. THE RNA BASES In RNA, the nitrogen bases are attached to a phosphate group & a sugar (ribose). Now, the bases are: A, C, G, U (uracil). How would the bases match up now? A – U, C – G, U – A, G - C

33. TRANSCRIPTION The DNA strand again “unzips” and free floating RNA bases match up with the unwound DNA strand. DNA strand: TGATGTCGTAGCTCATGCGTAC NEW RNA strand: ACUACAGCAUCGAGUACGCAUG

34. TYPES OF RNA There are 2 types of RNA that each have a different job in the process of making proteins. • mRNA= RNA on the strand • tRNA= Transports amino acids to ribosomes to be assembled into proteins

35. 3. PROTEIN (AMINO ACID) TRANSLATION After we have RNA, we can now make amino acids (which link together to form proteins.) How does this happen? • The RNA strand gets split into CODONS (3 RNA bases). Example: ACU

36. Translation • Once the RNA is split into codons, your body matches them up to a code to form the amino acid. There is a chart that has all 20 of the amino acid codes on it, along with a start & stop:

37. To use the chart: EXAMPLE mRNA CODON: ACU Look on the left side of the chart to find the first base (A). Look on the top of the chart to find the second base (C). Look on the right side of the chart to find the third base (U). THE AMINO ACID IS: Threonine

38. Abbreviating the amino acids Instead of writing out the entire name of each amino acid, you can abbreviate. The rule is: use the first 3 letters of the amino acid as the abbreviation. Except when the amino acid ends in the word “acid”, in which case you use the first 2 letters and a capital A.

39. The role of tRNA: Transfer RNA (tRNA) moves the mRNA codons to the ribosomes from the cytoplasm so they can be translated into proteins. Each tRNA molecule only fits onto ONE mRNA codon. Its ANTICODON fits onto the mRNA codon like a puzzle piece and carries it away.

40. THE END OF TRANSLATION Once the protein chain has been made, the body codes “stop”. The protein strand is cut and it goes off to do a job (like be a hair or skin protein.) So…the ORDER of amino acids determines the protein & how we are put together!

41. WHAT HAPPENS IF THE AMINO ACID ORDER CHANGES? THE PROTEIN CHANGES! And…if the protein changes…YOU CHANGE!

42. DNA Notes 5 • Mutations

43. GENETIC MUTATIONS A mutation is any permanent change in the DNA sequence. Mutations are caused by MUTAGENS like UV radiation, X-rays, toxins, etc. Some mutations are “silent” (do not have any effect). Some mutations have major effects like Down’s Syndrome or cancer.

44. TYPES OF MUTATIONS • Point mutations • Frameshift mutations • Chromosomal mutations

45. POINT MUTATIONS Point mutations are when ONE DNA BASE is CHANGED. THE DOG BIT THE CAT THE DOG BIT THE CAR What happened in the DNA strand? What probably happened in the body?

46. FRAMESHIFT MUTATIONS Frameshift mutations are when ONE DNA BASE is ADDED or DELETED. THE DOG BIT THE CAT THE DOG BIT HEC AT What happened in the DNA strand? What probably happened in the body?

47. CHROMOSOMAL MUTATIONS A chromosomal mutation is when MANY DNA BASES are CHANGED, ADDED or DELETED. THE DOG BIT THE CAT THE DGB ITE HAT C What happened in the DNA strand? What most likely happened in the body?

48. CAN MUTATIONS BE PASSED ON TO OFFSPRING (progeny)? Some can! If the mutation occurs in a BODY cell, they are called NON-INHERITED mutations. If the mutation occurs in a SEX cell (gamete) they are called INHERITED mutations & can be passed on.

49. Are all mutations bad? NO!Some mutations, like the ones that can be passed on to offspring, can create GENETIC VARIATION, or changes for the species.

50. Sex Cell Division MEIOSIS