1 / 37

Drew Endy endy@mit mit/endy/www/talks/  file here []

Policy Opportunities Related to the Engineering of Biology. Drew Endy endy@mit.edu http://mit.edu/endy/www/talks/  file here [.ppt] http://parts.mit.edu/  Registry of Standard Biological Parts April 11, 2005 MIT. Previous Page. Sequence (BNL). Dunn & Studier, J. Mol. Bio. 166 :477

xenon
Télécharger la présentation

Drew Endy endy@mit mit/endy/www/talks/  file here []

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. Policy Opportunities Related to the Engineering of Biology Drew Endyendy@mit.edu http://mit.edu/endy/www/talks/file here [.ppt] http://parts.mit.edu/Registry of Standard Biological Parts April 11, 2005 MIT

  2. Previous Page Sequence (BNL) Dunn & Studier, J. Mol. Bio.166:477 (1983)

  3. Wild-Type T7 Genes 2.8-3 ----------------2.8-----------------> acgcaaagggaggcgacatggcaggttacggcgctaaaggaatccgaaa <--3-RBS---><----------------3--------------

  4. Wild-Type T7 Genes 2.8-3 ----------------2.8-----------------> acgcaaagggaggcgacatggcaggttacggcgctaaaggaatccgaaa <--3-RBS---><----------------3-------------- T7.1 Parts 28 & 29 acgcaaGgggagAcgacaCggcaggttacggcgctaaggatccggccgcaaagggaggcgacatggcaggttacggcgctaaa ----------------2.8-----------------><D28R|D29L><--3RBS------><---------------3----

  5. PciI BclI NsiI MfeI SpeI ø1.6 øOL A1 A2 A2 C ø1.1A ø1.1B ø1.3 ø1.5 B BoxA TR/ SRL R0.3 0.3 0.4 R0.5 0.5 0.6A/B 0.7 R1 1 R1.1 1.1 1.2 R1.3 1.3 TE 1.4 1.5 1.6 1.7 A0

  6. BclI PciI NsiI MfeI SpeI 63 35 210 35 88 316 370 183 52 158 355 1102 91 2708 139 148 275 80 1099 65 173 35 110 279 164 443 ø1.6 øOL A1 A2 A2 C ø1.1A ø1.1B ø1.3 ø1.5 TR/ SRL BoxA R0.3 0.3 0.4 R0.5 0.5 0.6A/B 0.7 R1 1 R1.1 1.1 1.2 R1.3 1.3 TE 1.4 1.5 1.6 1.7 A0

  7. D2L SphI D1L BstEII D20L XbaI D3L BspDI D4L HindIII D5L BssHII D6L SexAI D7L MluI D8L BsiWI D9L RsrII D9.5L SacII D10L EagI D10.5L PacI D11L EcoRI D12L PfoI D13L EcoO1091 D14L XmaI D15L ApaI D16L NcoI D17L KasI D18L AvrII D19L AatII D21L AgeI D1R D2R D3R D4R D5R D6R D7R D8R D9R D9.5R D10R D10.5R D11R D12R D13R D14R D15R D16R D17R D18R D19R D20R D21R SacI NheI NsiI PciI MfeI ApaLI SpeI SapI BclI 63 35 210 35 88 316 370 183 52 158 355 1102 91 2708 139 148 275 80 1099 65 173 35 110 279 164 443 ø1.6 øOL A1 A2 A2 C ø1.1A ø1.1B ø1.3 ø1.5 TR/ SRL BoxA R0.3 0.3 0.4 R0.5 0.5 0.6A/B 0.7 R1 1 R1.1 1.1 1.2 R1.3 1.3 TE 1.4 1.5 1.6 1.7 A0

  8. D23L AvrII D24L EcoRI D25L XmaI D26L BamHI D27L EagI D28L SacII D29L PciI D30L SalI D22L BstEII D22R D23R D24R D25R D26R D27R D28R D29R D30R BglII 175 209 35 723 438 464 478 75 306 75 ø3.8 ø2.5 1.8 2 2.8 3 3.5 R3.8 3.8 2.5 D2L SphI D1L BstEII D20L XbaI D3L BspDI D4L HindIII D5L BssHII D6L SexAI D7L MluI D8L BsiWI D9L RsrII D9.5L SacII D10L EagI D10.5L PacI D11L EcoRI D12L PfoI D13L EcoO1091 D14L XmaI D15L ApaI D16L NcoI D17L KasI D18L AvrII D19L AatII D21L AgeI D1R D2R D3R D4R D5R D6R D7R D8R D9R D9.5R D10R D10.5R D11R D12R D13R D14R D15R D16R D17R D18R D19R D20R D21R AseI NsiI DraI BstEII BspHI EciI AvaI SpeI ScaI XcaI XbaI KpnI AcvI DraIII BlpI FspI AciI BspDI KasI D32L EagI D33L AscI D34L SgrI D35L HindIII D36L PfoI D37L NheI D38L SphI D39L NcoI D40L BamHI D41L SacII D42L ApaI D43L XmaI D44L SacI D45L XhoI D46L EcoRI D47L PvuI D48L RsrII D49L PstI D31L BsiWI SacI NheI NsiI PciI MfeI ApaLI SpeI SapI BclI D31R D32R D33R D34R D35R D36R D41R D44R D49R D37R D38R D39R D40R D42R D43R D45R D46R D47R D48R 63 35 210 35 88 316 370 183 52 158 355 1102 91 2708 139 148 275 80 1099 65 173 35 110 279 164 443 AauI BglI EciI AatI NsiI ø1.6 øOL A1 A2 A2 C ø1.1A ø1.1B ø1.3 ø1.5 TR/ SRL BoxA R0.3 0.3 0.4 R0.5 0.5 0.6A/B 0.7 R1 1 R1.1 1.1 1.2 R1.3 1.3 TE 1.4 1.5 1.6 1.7 A0 1762 35 213 270 69 408 2115 357 464 478 464 903 114 73 255 267 402 300 223 172 Ø4c Ø4.7 Ø6.5 Ø4.3 4A/4B/4.1/4.2 4.3 7.7 R4.7 R6.5 4.7 5 5.3 5.5 5.7 5.9 6 6.3 6.5 6.7 7 7.3 4.5 D50L BsiWI D51L PvuI D52L EcoRI D53L SacII D54L BamHI D55L XmaI D56L ApaI D57L HindIII FspI AvrII D50R D51R D52R D53R D54R D55R D56R D57R XbaI D57L HindIII D59L EcoRI D60L BsiWI D61L PvuI D62L EagI D58L PfoI RsrII BssHII AatII AvaI PacI D57R D58R D59R D60R D61R D62R ScaI NdeI PacI NciI AvaI BstBI ApaLI 1611 35 1038 35 464 73 591 2382 3 ø9 ø10 2382 3 62 417 591 2244 3520 437 8 10A Tø 12 9 11 ø13 12 13 14 16 R13 15 D64L HindIII D65L BamHI D66L XmaI D67L ApaI D68L EcoRI D69L BsiWI D70L PstI D71L SalI D63L SacII D63R D64R D65R D66R D67R D68R D69R D70R D71R BglI 35 1662 204 270 53 460 1761 35 150 160 E ø17 øOR 17 18 R18.5 18.5/18.7 19/19.2/19.3 19.5 17.5 SRR/TR

  9. Section alpha Section beta (1  8,311 bp) (8,311  12,179 bp)

  10. Refactor[1-12,179]:T7+ Wild-Type T7 (T7+)

  11. Kuroda-Kawaguchi et al., Nature Genetics29:279 (2001)

  12. Nature & Change Human & Engineer Nature & Form • Pre-existing • Immutable • Pre-existing • Immutable • Changing • Evolution • Pre-existing • Immutable • Changing • Evolution • Rational design • New • Decoupled • [e.g., disposable]

  13. Carlson, Pace & Proliferation of Biological Technologies, Biosec. & Bioterror.1(3):1 (2003)

  14. Goto Parts Goto NCBI. Goto BH Goto Cinnagen

  15. Enabling Biological Engineering • Standardization of Components • Predictable performance • Off-the-shelf • ME, 1800s • Abstraction • Insulate relevant characteristics from overwhelming detail • Simple artifacts that can be used in combination • From Physics to EE, 1900s • Decoupling Design & Fabrication • Rules insulating design process from details of fabrication • Enable parts, device, and system designers to work together • VLSI electronics, 1970s

  16. Biological Risk • Past and ongoing work • Breeding • Animal release • Recombinant DNA technology • (2) Liberal democracy in context of living world

  17. Biological Risk: Background Technology Classes Relevant to Biological Risk (current relative capabilities) Risk Manipulation Detection Analysis Response

  18. Biological Risk: Background Technology Classes Relevant to Biological Risk (current relative capabilities) Risk Manipulation Detection Analysis Response

  19. Biological Risk: Tactics as “Strategy” Maginot Line France, 1940 Anthrax vaccine SARS assay Ciprofloxacin VHF therapy (under construction) Plague vaccine (under construction) Smallpox vaccine

  20. Biological Risk: Background Technology Classes Relevant to Biological Risk (current relative capabilities) Risk Manipulation Detection Analysis Response

  21. Biological Risk: Future Strategy Technology Classes Relevant to Future Biological Risk (needed capabilities) Risk Manipulation Detection Analysis Response

  22. Biological Risk: Suite of Solutions Basic Researcher Garage Bio-Hacker Disgruntled Researcher Number of Individuals Bin Laden Genetics, Inc. honorable Individual’s Intent dishonorable

  23. Biological Risk: Hack the Living World?

  24. From: XXXX Subject: Endy Letter Date: January 6, 2005 9:45:17 AM EST To: endy@mit.edu Dr. Endy, I am a sophomore at XXXXX High School in Connecticut and have recently taken an interest in Synthetic Biology.I am writing to ask for your help because i am having difficulty in obtaining information,and understanding some of the information i already have. Anything you can send my way would be greatly appreciated… …I will soon begin working on a proposal to create a BioBrick, any information you can send me on their creation would be excellent. -Sincerely, XXXX XXXX XXXX High School -Grade 10

  25. A Constructive Society

  26. A Constructive Society

  27. UT SB Competition Team c/o Jeff Tabor

  28. UT SB Competition Team Light  PoPS Receiver BBa_I15010 BBa_R0082 Photons PoPS  Color Converter BBa_B0034 BBa_E0033 BBa_B0015 PoPS c/o Jeff Tabor

  29. UT SB Competition Team Lens ripped off of overhead projector Pile of cells/agar Casserole dish Thermostable chassis c/o Jeff Tabor

  30. UT SB Competition Team c/o Jeff Tabor

  31. iGEM 2005, 2006, … 2003 - MIT IAP (Blinkers) 2004 - MIT IAP (Polkadots) 2004 - BU, Caltech, MIT, Princeton, UT Austin (FSMs) 2005 - Intercollegiate Genetically Engineered Machine (iGEM) Competition Caltech Davidson Harvard MIT Toronto UCSF/SFSU UT Austin 2006 - Intercollegiate Genetically Engineering Machine (iGEM) Competition Oklahoma Princeton Cambridge ETH Zurich Penn State UC Berkeley

  32. Technology Opportunities • General Infrastructure Supporting the Engineering of Biology • Built from early days with foresight • Detection, Analysis, Response • Students running a bio-detector on the corner of Ames & Main • Education Opportunities • Undergraduate Program in Biological Engineering • Code of Ethics & Standards of Practice for Biological Engineers • Would likely need to be backstopped by a professional society(s) • Policy Opportunities • Coherent (?!) organization of federal funding • Integration of research and policy • Broad societal acceptance of responsibility for manipulating genetic information • International transparency? • Transition from “threat specific” to “capabilities-based” strategy • Distribution of technology? Open or closed?

  33. Acknowledgements I would like to acknowledge Adam Arkin, Frances Arnold, Ralph Baric, Roger Brent, Jehoshua Bruck, Carlos Bustamante, Barry Canton, Rob Carlson, Leon Chan, Austin Che, Jim Collins, Lynn Conway, Ron Davis, Mita Desai, John Doyle, Eric Eisenstadt, Michael Elowitz, Stephanie Forrest, Timothy Gardner, Seth Goldstein, Homme Hellinga, George Homsy, Joe Jacobsen, Tom Kalil, Jay Keasling, Heather Keller, Doug Kirkpatrick, Tom Knight, Sri Kosuri, Patrick Lincoln, John Mulligan, Richard Murray, Radhika Nagpal, Richard Newton, Carl Pabo, Randy Rettberg, Pamela Silver, Brad Smith, Christina Smolke, Gerry Sussman, Samantha Sutton, Claire Tomlin, Jeffrey Way, Chris Webb, Ron Weiss, Scot Wolfe, Aarne Vesilind, other members of the lab and the MIT Synthetic Biology Working Group, and the students and instructors of the 2003/4 MIT IAP Synthetic Biology Labs and the 2004 Synthetic Biology Competition for their direct contributions to the material presented here and to my current thinking about how to best engineer biology.

More Related