1 / 9

Chromosome 10

Chromosome 10. Kristen Dengler. Chromosome 10!!!. 135 million base pairs long Model is 13.5 inches long About 800-1200 genes found on it Average size: (10 largest) Represents 4-4.5% of total DNA in cell. All has been sequenced . GENES OF INTEREST. CXCL12 Located at 10q11.1

zorana
Télécharger la présentation

Chromosome 10

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript


  1. Chromosome 10 Kristen Dengler

  2. Chromosome 10!!! • 135 million base pairs long • Model is 13.5 inches long • About 800-1200 genes found on it • Average size: (10 largest) • Represents 4-4.5% of total DNA in cell. • All has been sequenced

  3. GENES OF INTEREST • CXCL12 • Located at 10q11.1 • Resistance to AIDS • It directs movement of lymphocytes (white blood cells) • During embryogenesis it directs hematopoietic cells q11.1

  4. GENES OF INTEREST • CYP17 • Located 10q24.3 • Makes an enzyme that enables the body to convert cholesterol into cortisol. • Also enables body to create hormones like testosterone. Without it puberty will not occur. • Mutations may be associated with prostate cancer or breast cancer.

  5. GENES OF INTEREST • DLG5 (Disks Large Homolog 5) • Located 10q23 • Susceptibility to Crohn’s Disease • Works on the membrane of the cell or the cytoskeleton q23

  6. GENES OF INTEREST • MAP3K8 • Located at 10p11.2 • Somatic Lung Cancer • Plays roll in cell cycle. p11.2

  7. Linked Genes • Partial Epilepsy has been found to be linked to chromosome 10 • Partial Epilepsy is when seizures occur in a specific area of the brain • Common neurological disorder • Linked to q arm. (Longer arm)

  8. Mutations!!! • Tremor and Reduced Life Span (trls) • Found mutation in chromosome 10 • Spontaneous recessive neurological mutation • Causes tremors, reduced body size, and a shortened life span • Other mutations in genes on chromosome 10 have lead to cancer and Crohns Disease

  9. Sample base sequence • GDF2 Gene • 1 cggtccagcccggcagcgggtgagagtgggtgctggccaggacggttccttcagagcaaa 61 cagcagggagatgccggcccgctccttcccagctcctccccgtgcccgct aacacagcac 121 ggccgcctgcagtctcctctctgggtgattgcgcgggcctaagatgtgtcctggggcact 181 gtgggtggccctgcccctgctgtccctgctggctggctccctacaggggaagccactgca 241 gagctggggacgagggtctgctgggggaaacgcccacagcccactgggggtgcctggagg 301 tgggctgcctgagcacaccttcaacctgaagatgtttctggagaacgtgaaggtggattt 361 cctgcgcagccttaacctgagtggggtcccttcgcaggacaaaaccagggtggagccgcc 421 gcagtacatgattgacctgtacaacaggtacacgtccgataagtcgactacgccagcgtc 481 caacattgtgcggagcttcagcatggaagatgccatctccataactgccacagaggactt 541 ccccttccagaagcacatcttgctcttcaacatctccattcctaggcatgagcagatcac 601 cagagctgagctccgactctatgtctcctgtcaaaatcacgtggacccctctcatgacct 661 gaaaggaagcgtggtcatttatgatgttctggatggaacagatgcctgggatagtgctac 721 agagaccaagaccttcctggtgtcccaggacattcaggatgagggctgggagaccttgga 781 agtgtccagcgccgtgaagcgctgggtccggtccgactccaccaagagcaaaaataagct 841 ggaagtgactgtggagagccacaggaagggctgcgacacgctggacatcagtgtcccccc 901 aggttccagaaacctgcccttctttgttgtcttctccaatgaccacagcagtgggaccaa 961 ggagaccaggctggagctgagggagatgatcagccatgaacaagagagcgtgctcaagaa 1021 gctgtccaaggacggctccacagaggcaggtgagagcagtcacgaggaggacacggatgg 1081 ccacgtggctgcggggtcgactttagccaggcggaaaaggagcgccggggctggcagcca 1141 ctgtcaaaagacctccctgcgggtaaacttcgaggacatcggctgggacagctggatcat 1201 tgcacccaaggagtatgaagcctacgagtgtaagggcggctgcttcttccccttggctga 1261 cgatgtgacgccgacgaaacacgctatcgtgcagaccctggtgcatctcaagttccccac 1321 aaaggtgggcaaggcctgctgtgtgcccaccaaactgagccccatctccgtcctctacaa 1381 ggatgacatgggggtgcccaccctcaagtaccattacgagggcatgagcgtggcagagtg 1441 tgggtgcaggtagtatctgcctgcggggctggggaggcaggccaaaggggctccacatga 1501 gaggtcctgcatgcccctgggcacaacaaggactgattcaatctgcatgccagcctggag 1561 gaggaaagggagcctgctctccctccccacaccccacccaaagcatacaccgctgagctc 1621 aactgccagggaaggctaaggaaatggggatttgagcacaacaggaaagcctgggagggt 1681 tgttgggatgcaaggaggtgatgaaaaggagacagggggaaaaataatccatagtcagca 1741 gaaaacaacagcagtgagccagaggagcacaggcgggcaggtcactgcagagactgatgg 1801 aagttagagaggtggaggaggccagctcgctccaaaacccttggggagtagagggaagga 1861 gcaggccgcgtgtcacacccatcattgtatgttatttcccacaacccagttggaggggca 1921 tggcttccaatttagagacc cg

More Related