1 / 22

ABIP Pan Canadian Fibre Trials, Biomass, Fibre Analysis and DNA markers

ABIP Pan Canadian Fibre Trials, Biomass, Fibre Analysis and DNA markers. John Vidmar Alberta Innovates- Future Technologies FibreLinks 15 Feb. 2011. What is hemp?. Hemp is one of the oldest non-food, fibre crops Originates from Central Asia where it was cultivated 6,500 years ago.

abiola
Télécharger la présentation

ABIP Pan Canadian Fibre Trials, Biomass, Fibre Analysis and DNA markers

An Image/Link below is provided (as is) to download presentation Download Policy: Content on the Website is provided to you AS IS for your information and personal use and may not be sold / licensed / shared on other websites without getting consent from its author. Content is provided to you AS IS for your information and personal use only. Download presentation by click this link. While downloading, if for some reason you are not able to download a presentation, the publisher may have deleted the file from their server. During download, if you can't get a presentation, the file might be deleted by the publisher.

E N D

Presentation Transcript

  1. ABIP Pan Canadian Fibre Trials, Biomass, Fibre Analysis and DNA markers John Vidmar Alberta Innovates- Future Technologies FibreLinks 15 Feb. 2011

  2. What is hemp? • Hemp is one of the oldest non-food, fibre crops • Originates from Central Asia where it was cultivated 6,500 years ago • Hemp (Cannabis sativa L.) has two subspecies: C. sativa and C. indica that differ in content of delta-9-tetrahydrocannabinol (THC) Industrial hemp < 0.3% Marijuana up to 40%

  3. Two types of fibre Long (bast) fibre -50 mm Cellulose - 50-70% Lignin – 5-7% Short (hurd) fibre -0.5 mm Cellulose - 35% Lignin – 20-30%

  4. Hemp acreage in Canada

  5. Objectives • Pan Canadian Industrial Hemp field trials Four sites (Alberta, Manitoba, Ontario and Quebec) • Five Canadian developed cultivars • Effect of N on Biomass and Fibrecharacteristics • Chemical characterization • Physical characterization • Development of Molecular Markers to support plant breeding activities (SSR) and (SNP) • Evaluation of variation and association of Fibre traits with Molecular Markers

  6. Genetic makeup – variety - Dry stalk yield (t/ha) Vegreville, 2009 Dauphin, 2009

  7. N level – Dry stalk yield (t/ha) Vegreville, 2008 Dauphin, 2008

  8. Fiber analysis - workflow

  9. Physical analysis of Biomass Platform 1B - SUMMARY Bast and Core fibre ratios (analysis for all successful field trials) Variation due to genotype Effect of N-treatment and level

  10. Genetic makeup – variety – Dry stalk Vegreville, 2009 Dauphin, 2009

  11. N trial – Vegreville, 2009 Anka USO14

  12. Microsatellites (SSR) workflow 1.Construction of a SSR-enriched genomic library 2. Primer design, Primer validation and PCR optimization 3. Primer screening for polymorphism 4. Linkage analysis and development of a genetic map 5. QTL mapping

  13. + Method – 1. Microsatellites (SSR) isolation Biotin capture with streptavidin-coated magnetic beads Substractive hybridization Isolate genomic DNA Washes-elution Cut DNA biotinylated probes Microsatellite-enriched DNA PCR amplification Adaptor Ligation Ligation PCR amplification Colony selection Cloning Sequencing Southern blot screen

  14. Design primers Hemp varieties TTCCGATGTCATCTTGCTGCATTTGCATGACGGCGTACACGACGACCCGCTAATCCACCC >>>>>>>>>>>>>>>>>>>>>>>> CTAGCCGTCTTCTTCCATCTCCCCTCCCATCGCTCTGTGTGTGTGTGTGTGTGTGTGTGT ******************************************* GTTGTATGTTTCTTATAAGCCAGTGGAGTCAAAATTGAAAATTAAAAAGTCTCAGCGGAC ** >>>>>>>>>>>>>>>> CTCATGCAAACAAGGATGACTCTTAAAACTGTTTTCATCGATATTCAAATGTGCTTCTGCTAG >>> GenomicDNA A B no DNA Tm 50-60ºC Mg2+ 1-3 mM Primer 0.2-1.0 μM PCR amplification A B - A B - A B - A B - A B - A B - A B - A B - A B - DNA 20-100 ng Method – 2. Primer design, validation and screening Unique sequences identified Sequence comparison Sequence data Primer validation PCR optimization Marker screening 8 hemp varieties PCR amplification

  15. Marker development 4F4 Polymorphism 2D12 1B12 No polymorphism

  16. Development Single Nucleotide Polymorphisms • Hemp genome (M. DeyholosABIP CBioN) • 850 Mbp • Using Solid4 next generation sequencer • Two genomic DNA libraries (IB Anka) • Draft assembly • Hemp (5 varieties) (J. Vidmar ABIP NAFGEN) • DNA Samples processed to be sequenced • Lower coverage • Comparison to Draft Assembly Goal detection of over 1000 SNP

  17. Summary • Develop Guide for Hemp Fibre Biomass • Provide information for industry • What varieties and where • Dependent on Gross needs of industry • Biomass, • fibre content (bast vs. core) • If other fibre characteristics • Cellulose/hemi-cellulose • Lignin • Marker discovery • Increase efficiency for development of improved varieties of Industrial hemp

  18. AITF • Jan Slaski • Mihaila Voicu • Julie Bernier • Susan Koziel • Corriane Coffey • Keith Lou University of Alberta • Michael Deyholos MAFRI (Manitoba) • Keith Watson OHA (Ontario) • Gordon Scheifele Lanaupole Fibre (Quebec) • Daniel Babineau

  19. Business Development/ Technical Capacity The Alberta Biomaterials Development Centre • Provincial initiative to develop biomaterials sector • Augments existing provincial R&D capacity. • Pools existing capital assets of host organizations • Pre-commercial or small demonstration scale processing Business Development ABDC Business Development/ Technical Capacity

  20. The ABDC’s of Creating Industry • Select Appropriate Pilot Plant Equipment for Industry Use • Flexible • Scaleable • Multiple Feedstocks • Large Pilot Scale (100 kg/h to 1000 kg/h) • Do not duplicate existing industry, enhance it and create partnerships to fill gaps • Develop new processes to address industry needs • Be able to transfer and implement knowledge and technology

  21. Decortication Pilot Plant

  22. Thank you!www.albertabiomaterials.ca

More Related